Rorug04G0261500

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000004
OG0009583
Physical Location & Seq
Reverse (-)
43349374 .. 43349607
234 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug04G0261500.1

Sequence Viewer

Length: 234 bp
ATGCATCTGCATGGTTTCATTTTCTATGTTGTTGGAAGGGGGCTTGGGGACTTTGACAAGGATAAGGAACCATTGAAATATAATCTTTTTGATCCACCTCTGCGGAACACTATTGCTGTCCCTGTAAATGGGTGGACTGCCATTAGATTCCAGGCTGACAATCCTGTAGTTTTGTTTATGCATTGCCATTTAGATAGGCATACGTCATGGAGCATGGAAGTAGACTCATGCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

77

Amino Acids

8.92

Weight (kDa)

6.15

Isoelectric Point (pI)

45.64

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Cu-oxidase_2 PF07731 1 - 72 5.4e-26 Multicopper oxidase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 222
AciI CCGC 1 cut(s) 103
AclWI GGATC 1 cut(s) 86
AfiI CCNNNNNNNGG 1 cut(s) 128
AgsI TTSAA 1 cut(s) 76
AjnI CCWGG 1 cut(s) 150
AlwI GGATC 1 cut(s) 86
BciT130I CCWGG 1 cut(s) 152
BfmI CTRYAG 1 cut(s) 165
Bme1390I CCNGG 1 cut(s) 152
BmiI GGNNCC 1 cut(s) 69
BmrFI CCNGG 1 cut(s) 152
BmsI GCATC 1 cut(s) 13
Bsc4I CCNNNNNNNGG 1 cut(s) 128
Bse3DI GCAATG 1 cut(s) 181
BseBI CCWGG 1 cut(s) 152
BseLI CCNNNNNNNGG 1 cut(s) 128
BseMI GCAATG 1 cut(s) 181
BslFI GGGAC 2 cut(s) 62, 104
BslI CCNNNNNNNGG 1 cut(s) 128
BsmFI GGGAC 2 cut(s) 62, 104
Bsp143I GATC 1 cut(s) 91
BspACI CCGC 1 cut(s) 103
BspLI GGNNCC 1 cut(s) 69
BspPI GGATC 1 cut(s) 86
BsrDI GCAATG 1 cut(s) 181
BssMI GATC 1 cut(s) 91
Bst2UI CCWGG 1 cut(s) 152
BstKTI GATC 1 cut(s) 94
BstMBI GATC 1 cut(s) 91
BstNI CCWGG 1 cut(s) 152
BstSCI CCNGG 1 cut(s) 150
BstSFI CTRYAG 1 cut(s) 165
CviAII CATG 4 cut(s) 11, 207, 214, 228
CviJI RGCY 2 cut(s) 43, 155
CviKI_1 RGCY 2 cut(s) 43, 155
DpnI GATC 1 cut(s) 93
DpnII GATC 1 cut(s) 91
EcoRII CCWGG 1 cut(s) 150
EcoT22I ATGCAT 2 cut(s) 6, 183
FaeI CATG 4 cut(s) 14, 210, 217, 231
FaiI YATR 8 cut(s) 12, 27, 81, 179, 201, 208, 215, 229
FaqI GGGAC 2 cut(s) 62, 104
FatI CATG 4 cut(s) 10, 206, 213, 227
FblI GTMKAC 1 cut(s) 222
Hin1II CATG 4 cut(s) 14, 210, 217, 231
HinfI GANTC 2 cut(s) 147, 224
Hpy166II GTNNAC 2 cut(s) 135, 223
Hpy8I GTNNAC 2 cut(s) 135, 223
HpyAV CCTTC 1 cut(s) 30
HpyCH4IV ACGT 1 cut(s) 203
HpyCH4V TGCA 3 cut(s) 4, 10, 181
HpySE526I ACGT 1 cut(s) 203
Hsp92II CATG 4 cut(s) 14, 210, 217, 231
Kzo9I GATC 1 cut(s) 91
LmnI GCTCC 1 cut(s) 210
LpnPI CCDG 4 cut(s) 135, 137, 164, 177
LweI GCATC 1 cut(s) 13
MaeII ACGT 1 cut(s) 203
MalI GATC 1 cut(s) 93
MboI GATC 1 cut(s) 91
MlyI GAGTC 1 cut(s) 218
MmeI TCCRAC 1 cut(s) 13
MnlI CCTC 1 cut(s) 108
Mph1103I ATGCAT 2 cut(s) 6, 183
MslI CAYNNNNRTG 1 cut(s) 9
MspR9I CCNGG 1 cut(s) 152
MvaI CCWGG 1 cut(s) 152
NdeII GATC 1 cut(s) 91
NlaIII CATG 4 cut(s) 14, 210, 217, 231
NlaIV GGNNCC 1 cut(s) 69
NsiI ATGCAT 2 cut(s) 6, 183
PfeI GAWTC 1 cut(s) 147
PleI GAGTC 1 cut(s) 218
PpsI GAGTC 1 cut(s) 218
Psp6I CCWGG 1 cut(s) 150
PspGI CCWGG 1 cut(s) 150
PspN4I GGNNCC 1 cut(s) 69
RseI CAYNNNNRTG 1 cut(s) 9
Sau3AI GATC 1 cut(s) 91
SchI GAGTC 1 cut(s) 218
ScrFI CCNGG 1 cut(s) 152
SetI ASST 2 cut(s) 100, 206
SfaNI GCATC 1 cut(s) 13
SfcI CTRYAG 1 cut(s) 165
SgeI CNNG 9 cut(s) 23, 56, 70, 134, 163, 164, 176, 219, 226
SmiMI CAYNNNNRTG 1 cut(s) 9
SsiI CCGC 1 cut(s) 103
StyD4I CCNGG 1 cut(s) 150
TaiI ACGT 1 cut(s) 206
TfiI GAWTC 1 cut(s) 147
TspDTI ATGAA 1 cut(s) 7
XmiI GTMKAC 1 cut(s) 222
Zsp2I ATGCAT 2 cut(s) 6, 183
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.