Rorug06G0078400

3-ketoacyl-CoA synthase

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000006
Physical Location & Seq
Forward (+)
10472845 .. 10473832
988 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug06G0078400.1

Sequence Viewer

Length: 213 bp
ATGGGTCTGGTCGAATATCAAACTCAGCTCTCTGCATACAATCTATCTACTTCCGTATCATATACAGAGGTCATCTCTTTCTCCTTGAACTTAAGTAGCGGTAAGTTAGGTTATGATGAAAACGATGATGTAACCACCGAAGACATGGCTTTGGAGGTAATCACAGAAAGTTGTAAAGTAACTCAAATAAGTAGCTCAGACACAAGAAGGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

70

Amino Acids

7.72

Weight (kDa)

4.06

Isoelectric Point (pI)

37.06

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0016756)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g12940
malus_domestica MD10G1036400.v1.1
prunus_persica Prupe.8G042200_v2.0.a1
pyrus_communis pycom05g02490 pycom10g02490
rosa_chinensis RchiOBHm_Chr6g0274011
rosa_laevigata RLG00000013584
rosa_multiflora Rmu_sc0002247.1_g000012
rosa_rugosa Rorug06G0078400
rosa_samantha Rh6AG193900 Rh6BG197500 Rh6CG197600 Rh6DG189300
rosa_wichuraiana Rw6G016910

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 99
AflII CTTAAG 1 cut(s) 91
AgsI TTSAA 1 cut(s) 88
AluBI AGCT 2 cut(s) 28, 195
AluI AGCT 2 cut(s) 28, 195
BaeI ACNNNNGTAYC 2 cut(s) 39, 72
BbsI GAAGAC 1 cut(s) 147
BfrI CTTAAG 1 cut(s) 91
BpiI GAAGAC 1 cut(s) 147
BplI GAGNNNNNCTC 2 cut(s) 59, 91
BseMII CTCAG 2 cut(s) 38, 210
BspACI CCGC 1 cut(s) 99
BspCNI CTCAG 2 cut(s) 37, 209
BspTI CTTAAG 1 cut(s) 91
BstAFI CTTAAG 1 cut(s) 91
BstDEI CTNAG 2 cut(s) 24, 196
BstV2I GAAGAC 1 cut(s) 147
CviAII CATG 1 cut(s) 145
CviJI RGCY 3 cut(s) 28, 149, 195
CviKI_1 RGCY 3 cut(s) 28, 149, 195
DdeI CTNAG 2 cut(s) 24, 196
FaeI CATG 1 cut(s) 148
FaiI YATR 5 cut(s) 37, 61, 63, 114, 146
FatI CATG 1 cut(s) 144
Hin1II CATG 1 cut(s) 148
Hpy188I TCNGA 1 cut(s) 199
HpyAV CCTTC 1 cut(s) 201
HpyCH4V TGCA 1 cut(s) 35
HpyF3I CTNAG 2 cut(s) 24, 196
Hsp92II CATG 1 cut(s) 148
MaeIII GTNAC 2 cut(s) 130, 178
MboII GAAGA 1 cut(s) 152
MnlI CCTC 2 cut(s) 61, 148
MseI TTAA 1 cut(s) 92
MspCI CTTAAG 1 cut(s) 91
NlaIII CATG 1 cut(s) 148
SaqAI TTAA 1 cut(s) 92
SetI ASST 6 cut(s) 30, 72, 112, 159, 197, 212
SgeI CNNG 3 cut(s) 20, 97, 157
SmlI CTYRAG 1 cut(s) 91
SmoI CTYRAG 1 cut(s) 91
SsiI CCGC 1 cut(s) 99
TaqI TCGA 1 cut(s) 12
Tru1I TTAA 1 cut(s) 92
Tru9I TTAA 1 cut(s) 92
TspDTI ATGAA 1 cut(s) 132
TspGWI ACGGA 1 cut(s) 43
Vha464I CTTAAG 1 cut(s) 91
XcmI CCANNNNNNNNNTGG 1 cut(s) 142
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.