Rorug06G0388900

N-terminal C2 in EEIG1 and EHBP1 proteins

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000006
OG0006024
Physical Location & Seq
Forward (+)
53338287 .. 53338571
285 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug06G0388900.1

Sequence Viewer

Length: 285 bp
ATGACCAAGGAGCAGAGCCATGTACGTTTTCACAACACTTGGAGGAACTCGATCGGGGTTACCTTGCACGTACCAGAGTGGACCACAAACCGTGCTATATCGGAGAAGAGTGATGTGTATAGCTATGGAATGCTGTTGCTAGAGATTATCGGTGGGAGAAAGAACTATGACCAATCAGAAAGTTCTGAAAAATCTCAATTTCCATCCTATGCCTTCAAGATGCTAAATGAAGGCAAAATGAAGGACATTGTCGACTCCAAGCTGAAGATAGACTACGGCGACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
NT-C2

Protein Analysis

94

Amino Acids

10.91

Weight (kDa)

6.83

Isoelectric Point (pI)

43.16

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PK_Tyr_Ser-Thr PF07714 16 - 67 8.1e-07 Protein tyrosine and serine/threonine kinase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 252
AcuI CTGAAG 1 cut(s) 284
AfaI GTAC 2 cut(s) 24, 72
AgsI TTSAA 1 cut(s) 217
AluBI AGCT 2 cut(s) 123, 262
AluI AGCT 2 cut(s) 123, 262
AspS9I GGNCC 1 cut(s) 81
AvaII GGWCC 1 cut(s) 81
BarI GAAGNNNNNNTAC 1 cut(s) 257
BccI CCATC 1 cut(s) 211
BfaI CTAG 2 cut(s) 140, 283
Bme18I GGWCC 1 cut(s) 81
BmgT120I GGNCC 1 cut(s) 81
BmsI GCATC 1 cut(s) 210
BsaAI YACGTR 1 cut(s) 70
BsaJI CCNNGG 1 cut(s) 6
BseDI CCNNGG 1 cut(s) 6
BseGI GGATG 1 cut(s) 203
Bsh1285I CGRYCG 1 cut(s) 54
BsiEI CGRYCG 1 cut(s) 54
BsmI GAATGC 1 cut(s) 135
Bsp143I GATC 1 cut(s) 51
BssECI CCNNGG 1 cut(s) 6
BssMI GATC 1 cut(s) 51
BssT1I CCWWGG 1 cut(s) 6
Bst4CI ACNGT 1 cut(s) 92
Bst6I CTCTTC 1 cut(s) 101
BstBAI YACGTR 1 cut(s) 70
BstEII GGTNACC 1 cut(s) 58
BstF5I GGATG 1 cut(s) 203
BstKTI GATC 1 cut(s) 54
BstMBI GATC 1 cut(s) 51
BstMCI CGRYCG 1 cut(s) 54
BstPI GGTNACC 1 cut(s) 58
BtsCI GGATG 1 cut(s) 203
Cfr13I GGNCC 1 cut(s) 81
Csp6I GTAC 2 cut(s) 23, 71
CviAII CATG 1 cut(s) 20
CviJI RGCY 3 cut(s) 18, 123, 262
CviKI_1 RGCY 3 cut(s) 18, 123, 262
CviQI GTAC 2 cut(s) 23, 71
DpnI GATC 1 cut(s) 53
DpnII GATC 1 cut(s) 51
Eam1104I CTCTTC 1 cut(s) 101
EarI CTCTTC 1 cut(s) 101
Eco130I CCWWGG 1 cut(s) 6
Eco47I GGWCC 1 cut(s) 81
Eco57I CTGAAG 1 cut(s) 284
Eco91I GGTNACC 1 cut(s) 58
EcoO65I GGTNACC 1 cut(s) 58
EcoT14I CCWWGG 1 cut(s) 6
ErhI CCWWGG 1 cut(s) 6
FaeI CATG 1 cut(s) 23
FaiI YATR 6 cut(s) 21, 98, 120, 126, 168, 210
FatI CATG 1 cut(s) 19
FblI GTMKAC 1 cut(s) 252
FokI GGATG 1 cut(s) 190
FspBI CTAG 2 cut(s) 140, 283
Hin1II CATG 1 cut(s) 23
HincII GTYRAC 1 cut(s) 253
HindII GTYRAC 1 cut(s) 253
HinfI GANTC 1 cut(s) 254
Hpy166II GTNNAC 2 cut(s) 81, 253
Hpy188I TCNGA 3 cut(s) 103, 178, 187
Hpy188III TCNNGA 1 cut(s) 217
Hpy8I GTNNAC 2 cut(s) 81, 253
HpyAV CCTTC 3 cut(s) 223, 224, 235
HpyCH4III ACNGT 1 cut(s) 92
HpyCH4IV ACGT 2 cut(s) 25, 69
HpyCH4V TGCA 1 cut(s) 67
HpySE526I ACGT 2 cut(s) 25, 69
Hsp92II CATG 1 cut(s) 23
Kzo9I GATC 1 cut(s) 51
LmnI GCTCC 1 cut(s) 10
LpnPI CCDG 1 cut(s) 87
LweI GCATC 1 cut(s) 210
MaeI CTAG 2 cut(s) 140, 283
MaeII ACGT 2 cut(s) 25, 69
MaeIII GTNAC 1 cut(s) 58
MalI GATC 1 cut(s) 53
MboI GATC 1 cut(s) 51
MboII GAAGA 2 cut(s) 118, 277
MluCI AATT 1 cut(s) 197
MlyI GAGTC 1 cut(s) 248
MnlI CCTC 1 cut(s) 36
Mva1269I GAATGC 1 cut(s) 135
NdeII GATC 1 cut(s) 51
NlaIII CATG 1 cut(s) 23
PctI GAATGC 1 cut(s) 135
PflFI GACNNNGTC 1 cut(s) 248
Ple19I CGATCG 1 cut(s) 54
PleI GAGTC 1 cut(s) 248
PpsI GAGTC 1 cut(s) 248
Ppu21I YACGTR 1 cut(s) 70
PspEI GGTNACC 1 cut(s) 58
PspPI GGNCC 1 cut(s) 81
PsyI GACNNNGTC 1 cut(s) 248
PvuI CGATCG 1 cut(s) 54
RsaI GTAC 2 cut(s) 24, 72
RsaNI GTAC 2 cut(s) 23, 71
SalI GTCGAC 1 cut(s) 251
Sau3AI GATC 1 cut(s) 51
Sau96I GGNCC 1 cut(s) 81
SchI GAGTC 1 cut(s) 248
SetI ASST 5 cut(s) 28, 65, 72, 125, 264
SfaNI GCATC 1 cut(s) 210
SinI GGWCC 1 cut(s) 81
Sse9I AATT 1 cut(s) 197
SspMI CTAG 2 cut(s) 140, 283
StyI CCWWGG 1 cut(s) 6
TaaI ACNGT 1 cut(s) 92
TaiI ACGT 2 cut(s) 28, 72
TaqI TCGA 2 cut(s) 50, 252
TasI AATT 1 cut(s) 197
TspDTI ATGAA 2 cut(s) 243, 254
Tth111I GACNNNGTC 1 cut(s) 248
VpaK11BI GGWCC 1 cut(s) 81
XmiI GTMKAC 1 cut(s) 252
XspI CTAG 2 cut(s) 140, 283
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.