Rh1AG046900

SEC-C motif

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1A
Physical Location & Seq
Reverse (-)
7969627 .. 7971568
1942 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1AG046900.1

Sequence Viewer

Length: 243 bp
ATGGAATCACCTGGATTTGCGAACGAGATGAAGACCGGTAGAAGAGTAGGGGCATTCAAGCAATACATTGTTGGGAGAAGCAGTGAAGCGACTTTTGCCGATGCATTTGAGAAGCAGGAATCGATAATACGATATCTTGGAGGATTTGATTCTACTGGAGAGGTGGAACATTATCCGTTTATTCATTACCCTGTTGATGCAAACATAAGGGTTATTTCTAACTCCAACCATATCAGAACATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

80

Amino Acids

9.04

Weight (kDa)

6.26

Isoelectric Point (pI)

69.46

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0019346)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgeI ACCGGT 1 cut(s) 35
AgsI TTSAA 1 cut(s) 58
AjnI CCWGG 1 cut(s) 10
AsiGI ACCGGT 1 cut(s) 35
BbsI GAAGAC 1 cut(s) 38
BciT130I CCWGG 1 cut(s) 12
Bme1390I CCNGG 1 cut(s) 12
BmrFI CCNGG 1 cut(s) 12
BmsI GCATC 2 cut(s) 91, 187
BpiI GAAGAC 1 cut(s) 38
BpmI CTGGAG 1 cut(s) 177
Bsa29I ATCGAT 1 cut(s) 122
BsaWI WCCGGW 1 cut(s) 35
BsaXI ACNNNNNCTCC 2 cut(s) 67, 97
Bse118I RCCGGY 1 cut(s) 35
Bse1I ACTGG 1 cut(s) 160
BseBI CCWGG 1 cut(s) 12
BseCI ATCGAT 1 cut(s) 122
BseNI ACTGG 1 cut(s) 160
BshTI ACCGGT 1 cut(s) 35
BshVI ATCGAT 1 cut(s) 122
BsiSI CCGG 1 cut(s) 36
BsmI GAATGC 1 cut(s) 53
BspDI ATCGAT 1 cut(s) 122
BsrFI RCCGGY 1 cut(s) 35
BsrI ACTGG 1 cut(s) 160
BssAI RCCGGY 1 cut(s) 35
Bst2UI CCWGG 1 cut(s) 12
Bst6I CTCTTC 1 cut(s) 37
BstMWI GCNNNNNNNGC 1 cut(s) 95
BstNI CCWGG 1 cut(s) 12
BstSCI CCNGG 1 cut(s) 10
BstV2I GAAGAC 1 cut(s) 38
Bsu15I ATCGAT 1 cut(s) 122
BsuTUI ATCGAT 1 cut(s) 122
BtsI GCAGTG 1 cut(s) 88
BtsIMutI CAGTG 1 cut(s) 88
Cfr10I RCCGGY 1 cut(s) 35
ClaI ATCGAT 1 cut(s) 122
CspAI ACCGGT 1 cut(s) 35
CviAII CATG 1 cut(s) 240
Eam1104I CTCTTC 1 cut(s) 37
EarI CTCTTC 1 cut(s) 37
Eco32I GATATC 1 cut(s) 134
EcoRII CCWGG 1 cut(s) 10
EcoRV GATATC 1 cut(s) 134
EcoT22I ATGCAT 1 cut(s) 106
FaeI CATG 1 cut(s) 243
FaiI YATR 3 cut(s) 206, 231, 241
FatI CATG 1 cut(s) 239
GsuI CTGGAG 1 cut(s) 177
HapII CCGG 1 cut(s) 36
Hin1II CATG 1 cut(s) 243
HinfI GANTC 3 cut(s) 5, 119, 149
HpaII CCGG 1 cut(s) 36
Hpy188I TCNGA 1 cut(s) 236
HpyCH4V TGCA 2 cut(s) 104, 200
HpyF10VI GCNNNNNNNGC 1 cut(s) 95
Hsp92II CATG 1 cut(s) 243
LpnPI CCDG 5 cut(s) 24, 49, 101, 141, 204
LweI GCATC 2 cut(s) 91, 187
MboII GAAGA 2 cut(s) 43, 54
MnlI CCTC 2 cut(s) 134, 154
Mph1103I ATGCAT 1 cut(s) 106
MspI CCGG 1 cut(s) 36
MspR9I CCNGG 1 cut(s) 12
Mva1269I GAATGC 1 cut(s) 53
MvaI CCWGG 1 cut(s) 12
MwoI GCNNNNNNNGC 1 cut(s) 95
NlaIII CATG 1 cut(s) 243
NsiI ATGCAT 1 cut(s) 106
PctI GAATGC 1 cut(s) 53
PfeI GAWTC 3 cut(s) 5, 119, 149
PinAI ACCGGT 1 cut(s) 35
Psp6I CCWGG 1 cut(s) 10
PspGI CCWGG 1 cut(s) 10
ScrFI CCNGG 1 cut(s) 12
SetI ASST 2 cut(s) 13, 165
SfaNI GCATC 2 cut(s) 91, 187
SgeI CNNG 9 cut(s) 23, 24, 37, 48, 70, 128, 149, 168, 203
StyD4I CCNGG 1 cut(s) 10
TaqI TCGA 1 cut(s) 122
TfiI GAWTC 3 cut(s) 5, 119, 149
TscAI CASTG 1 cut(s) 88
TspDTI ATGAA 2 cut(s) 44, 173
TspGWI ACGGA 1 cut(s) 165
TspRI CASTG 1 cut(s) 88
Zsp2I ATGCAT 1 cut(s) 106
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.