Rh6DG380000

SEC-C motif

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6D
Physical Location & Seq
Reverse (-)
57378112 .. 57380579
2468 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6DG380000.1

Sequence Viewer

Length: 435 bp
ATGGAATCACCTGGATTTGCGGACGAGATGAAGACTGCTAGAAGAGTAGGGGCATTCAAGCAATACATTGTTGGGAGAAGCAGTGAAGCAACTTTTGCTGATGCATTTGAGAAGCAGGAATCGATAATACGATATCTCGGAGGATTTGATTCTACTCGAGAGAATCTCCAAATCACGCAAAAACAAGAAGCAGCAAAGCATTGTAAATGCTCAATAGCTGATGTTGAGAATGCACTTGCAAAGTTCACCTGGGCTAGGGAAGCACACAATAAGATGGAAAAGTTAAAGGCAGAAGGGAAACCAATCCAACAAACATTGGCGAGGTATTATATCTTAAATTTTCCTTTCCTTCATACATCCCAGGTTATTGAAAATCACCACACAGGGATGAACCTTACTAAGTTAGTATCTCTAAATTGGTGGAATTATCAGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

144

Amino Acids

16.59

Weight (kDa)

8.87

Isoelectric Point (pI)

39.39

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0019346)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 20
AcsI RAATTY 1 cut(s) 337
AfiI CCNNNNNNNGG 1 cut(s) 255
AgsI TTSAA 2 cut(s) 58, 371
AjnI CCWGG 3 cut(s) 10, 248, 360
AluBI AGCT 1 cut(s) 218
AluI AGCT 1 cut(s) 218
Ama87I CYCGRG 1 cut(s) 156
ApeKI GCWGC 1 cut(s) 191
ApoI RAATTY 1 cut(s) 337
AsuHPI GGTGA 2 cut(s) 238, 368
AvaI CYCGRG 1 cut(s) 156
BbsI GAAGAC 1 cut(s) 38
BbvI GCAGC 1 cut(s) 203
BccI CCATC 1 cut(s) 268
BciT130I CCWGG 3 cut(s) 12, 250, 362
BfaI CTAG 2 cut(s) 39, 255
BisI GCNGC 1 cut(s) 192
BlsI GCNGC 1 cut(s) 193
Bme1390I CCNGG 3 cut(s) 12, 250, 362
BmeT110I CYCGRG 1 cut(s) 156
BmrFI CCNGG 3 cut(s) 12, 250, 362
BmsI GCATC 1 cut(s) 91
BpiI GAAGAC 1 cut(s) 38
BplI GAGNNNNNCTC 2 cut(s) 150, 182
Bsa29I ATCGAT 1 cut(s) 122
BsaJI CCNNGG 2 cut(s) 249, 360
BsaXI ACNNNNNCTCC 2 cut(s) 67, 97
Bsc4I CCNNNNNNNGG 1 cut(s) 255
BseBI CCWGG 3 cut(s) 12, 250, 362
BseCI ATCGAT 1 cut(s) 122
BseDI CCNNGG 2 cut(s) 249, 360
BseGI GGATG 2 cut(s) 356, 393
BseLI CCNNNNNNNGG 1 cut(s) 255
BseXI GCAGC 1 cut(s) 203
BshVI ATCGAT 1 cut(s) 122
BsiHKCI CYCGRG 1 cut(s) 156
BslI CCNNNNNNNGG 1 cut(s) 255
BsmI GAATGC 2 cut(s) 53, 235
BsoBI CYCGRG 1 cut(s) 156
BspACI CCGC 1 cut(s) 20
BspDI ATCGAT 1 cut(s) 122
BssECI CCNNGG 2 cut(s) 249, 360
Bst2UI CCWGG 3 cut(s) 12, 250, 362
Bst6I CTCTTC 1 cut(s) 37
BstAPI GCANNNNNTGC 1 cut(s) 95
BstDEI CTNAG 1 cut(s) 399
BstENI CCTNNNNNAGG 1 cut(s) 253
BstF5I GGATG 2 cut(s) 356, 393
BstMWI GCNNNNNNNGC 2 cut(s) 95, 260
BstNI CCWGG 3 cut(s) 12, 250, 362
BstSCI CCNGG 3 cut(s) 10, 248, 360
BstV1I GCAGC 1 cut(s) 203
BstV2I GAAGAC 1 cut(s) 38
Bsu15I ATCGAT 1 cut(s) 122
BsuTUI ATCGAT 1 cut(s) 122
BtsCI GGATG 2 cut(s) 356, 393
BtsI GCAGTG 1 cut(s) 88
BtsIMutI CAGTG 1 cut(s) 88
ClaI ATCGAT 1 cut(s) 122
CviJI RGCY 2 cut(s) 218, 254
CviKI_1 RGCY 2 cut(s) 218, 254
DdeI CTNAG 1 cut(s) 399
Eam1104I CTCTTC 1 cut(s) 37
EarI CTCTTC 1 cut(s) 37
Eco32I GATATC 1 cut(s) 134
Eco88I CYCGRG 1 cut(s) 156
EcoNI CCTNNNNNAGG 1 cut(s) 253
EcoRII CCWGG 3 cut(s) 10, 248, 360
EcoRV GATATC 1 cut(s) 134
EcoT22I ATGCAT 1 cut(s) 106
FaiI YATR 2 cut(s) 330, 354
Fnu4HI GCNGC 1 cut(s) 192
FokI GGATG 2 cut(s) 343, 400
Fsp4HI GCNGC 1 cut(s) 192
FspBI CTAG 2 cut(s) 39, 255
GluI GCNGC 1 cut(s) 192
HinfI GANTC 4 cut(s) 5, 119, 149, 163
HphI GGTGA 2 cut(s) 238, 368
Hpy166II GTNNAC 1 cut(s) 246
Hpy188I TCNGA 1 cut(s) 140
Hpy188III TCNNGA 1 cut(s) 158
Hpy8I GTNNAC 1 cut(s) 246
HpyAV CCTTC 2 cut(s) 287, 359
HpyCH4V TGCA 3 cut(s) 104, 233, 239
HpyF10VI GCNNNNNNNGC 2 cut(s) 95, 260
HpyF3I CTNAG 1 cut(s) 399
LpnPI CCDG 7 cut(s) 24, 101, 235, 262, 347, 369, 374
Lsp1109I GCAGC 1 cut(s) 203
LweI GCATC 1 cut(s) 91
MaeI CTAG 2 cut(s) 39, 255
MboII GAAGA 2 cut(s) 43, 54
MluCI AATT 3 cut(s) 337, 415, 424
MmeI TCCRAC 1 cut(s) 331
MnlI CCTC 2 cut(s) 134, 315
Mph1103I ATGCAT 1 cut(s) 106
MseI TTAA 2 cut(s) 284, 335
MslI CAYNNNNRTG 1 cut(s) 386
MspR9I CCNGG 3 cut(s) 12, 250, 362
Mva1269I GAATGC 2 cut(s) 53, 235
MvaI CCWGG 3 cut(s) 12, 250, 362
MwoI GCNNNNNNNGC 2 cut(s) 95, 260
NsiI ATGCAT 1 cut(s) 106
PaeR7I CTCGAG 1 cut(s) 156
PctI GAATGC 2 cut(s) 53, 235
PfeI GAWTC 4 cut(s) 5, 119, 149, 163
PkrI GCNGC 1 cut(s) 193
Psp6I CCWGG 3 cut(s) 10, 248, 360
PspGI CCWGG 3 cut(s) 10, 248, 360
RseI CAYNNNNRTG 1 cut(s) 386
SaqAI TTAA 2 cut(s) 284, 335
SatI GCNGC 1 cut(s) 192
ScrFI CCNGG 3 cut(s) 12, 250, 362
SetI ASST 6 cut(s) 13, 220, 251, 326, 366, 396
SfaNI GCATC 1 cut(s) 91
Sfr274I CTCGAG 1 cut(s) 156
SlaI CTCGAG 1 cut(s) 156
SmiMI CAYNNNNRTG 1 cut(s) 386
SmlI CTYRAG 1 cut(s) 156
SmoI CTYRAG 1 cut(s) 156
Sse9I AATT 3 cut(s) 337, 415, 424
SsiI CCGC 1 cut(s) 20
SspMI CTAG 2 cut(s) 39, 255
StyD4I CCNGG 3 cut(s) 10, 248, 360
TaqI TCGA 2 cut(s) 122, 157
TasI AATT 3 cut(s) 337, 415, 424
TfiI GAWTC 4 cut(s) 5, 119, 149, 163
Tru1I TTAA 2 cut(s) 284, 335
Tru9I TTAA 2 cut(s) 284, 335
TscAI CASTG 1 cut(s) 88
TseI GCWGC 1 cut(s) 191
TspDTI ATGAA 3 cut(s) 44, 341, 404
TspRI CASTG 1 cut(s) 88
XagI CCTNNNNNAGG 1 cut(s) 253
XapI RAATTY 1 cut(s) 337
XhoI CTCGAG 1 cut(s) 156
XspI CTAG 2 cut(s) 39, 255
Zsp2I ATGCAT 1 cut(s) 106
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.