Rh1AG068700

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1A
Physical Location & Seq
Forward (+)
11528836 .. 11531454
2619 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1AG068700.1

Sequence Viewer

Length: 231 bp
ATGGATTTTGATGACGACGACGATGATGGTTGGGAATTCATACCTGCAAAACTAGAGAACCAGGTTGGCAACAAGAATTCTAAGTATGATGAAGGTTCAAATCCAGGAATCATTGTTCGTAGGCCTCAGGTTAAGGACTTTATCACCAAACACAACTTTCCTAATGATGTCCCTGATGAACTTGTTGAAGACTGTTCTAACTGGATTACTGTAAATCCTCTTGTAATATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

76

Amino Acids

8.72

Weight (kDa)

4.13

Isoelectric Point (pI)

28.81

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0022620)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr1g0325571
rosa_laevigata RLG00000027061
rosa_samantha Rh1AG068700 Rh1CG069000

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 52
AcsI RAATTY 2 cut(s) 35, 76
AgsI TTSAA 2 cut(s) 99, 188
AjnI CCWGG 2 cut(s) 60, 103
AloI GAACNNNNNNTCC 2 cut(s) 99, 131
AoxI GGCC 1 cut(s) 122
ApoI RAATTY 2 cut(s) 35, 76
AsuHPI GGTGA 1 cut(s) 136
AxyI CCTNAGG 1 cut(s) 126
BbsI GAAGAC 1 cut(s) 195
BccI CCATC 1 cut(s) 20
BciT130I CCWGG 2 cut(s) 62, 105
BfaI CTAG 1 cut(s) 53
BfuAI ACCTGC 1 cut(s) 52
Bme1390I CCNGG 2 cut(s) 62, 105
BmrFI CCNGG 2 cut(s) 62, 105
BpiI GAAGAC 1 cut(s) 195
Bse1I ACTGG 1 cut(s) 206
Bse21I CCTNAGG 1 cut(s) 126
BseBI CCWGG 2 cut(s) 62, 105
BseMII CTCAG 1 cut(s) 140
BseNI ACTGG 1 cut(s) 206
BshFI GGCC 1 cut(s) 124
BslFI GGGAC 1 cut(s) 155
BsmFI GGGAC 1 cut(s) 155
BsnI GGCC 1 cut(s) 124
BspANI GGCC 1 cut(s) 124
BspCNI CTCAG 1 cut(s) 139
BspMI ACCTGC 1 cut(s) 52
BsrI ACTGG 1 cut(s) 206
Bst2UI CCWGG 2 cut(s) 62, 105
Bst4CI ACNGT 2 cut(s) 194, 211
BstDEI CTNAG 2 cut(s) 81, 126
BstNI CCWGG 2 cut(s) 62, 105
BstSCI CCNGG 2 cut(s) 60, 103
BstV2I GAAGAC 1 cut(s) 195
Bsu36I CCTNAGG 1 cut(s) 126
BsuRI GGCC 1 cut(s) 124
BveI ACCTGC 1 cut(s) 52
CsiI ACCWGGT 1 cut(s) 60
CviJI RGCY 1 cut(s) 124
CviKI_1 RGCY 1 cut(s) 124
DdeI CTNAG 2 cut(s) 81, 126
Eco147I AGGCCT 1 cut(s) 124
Eco81I CCTNAGG 1 cut(s) 126
EcoRI GAATTC 2 cut(s) 35, 76
EcoRII CCWGG 2 cut(s) 60, 103
FaiI YATR 3 cut(s) 41, 87, 229
FaqI GGGAC 1 cut(s) 155
FspBI CTAG 1 cut(s) 53
HaeIII GGCC 1 cut(s) 124
HinfI GANTC 1 cut(s) 108
HphI GGTGA 1 cut(s) 136
Hpy99I CGWCG 2 cut(s) 20, 23
HpyAV CCTTC 1 cut(s) 86
HpyCH4III ACNGT 2 cut(s) 194, 211
HpyCH4V TGCA 1 cut(s) 47
HpyF3I CTNAG 2 cut(s) 81, 126
LpnPI CCDG 8 cut(s) 47, 57, 74, 90, 113, 117, 186, 187
MabI ACCWGGT 1 cut(s) 60
MaeI CTAG 1 cut(s) 53
MboII GAAGA 1 cut(s) 200
MluCI AATT 2 cut(s) 35, 76
MnlI CCTC 2 cut(s) 135, 228
MseI TTAA 1 cut(s) 132
MspR9I CCNGG 2 cut(s) 62, 105
MvaI CCWGG 2 cut(s) 62, 105
PceI AGGCCT 1 cut(s) 124
PfeI GAWTC 1 cut(s) 108
PfoI TCCNGGA 1 cut(s) 103
Psp6I CCWGG 2 cut(s) 60, 103
PspGI CCWGG 2 cut(s) 60, 103
SaqAI TTAA 1 cut(s) 132
ScrFI CCNGG 2 cut(s) 62, 105
SetI ASST 4 cut(s) 46, 66, 97, 132
SexAI ACCWGGT 1 cut(s) 60
Sse9I AATT 2 cut(s) 35, 76
SseBI AGGCCT 1 cut(s) 124
SspMI CTAG 1 cut(s) 53
StuI AGGCCT 1 cut(s) 124
StyD4I CCNGG 2 cut(s) 60, 103
TaaI ACNGT 2 cut(s) 194, 211
TasI AATT 2 cut(s) 35, 76
TfiI GAWTC 1 cut(s) 108
Tru1I TTAA 1 cut(s) 132
Tru9I TTAA 1 cut(s) 132
TspDTI ATGAA 3 cut(s) 28, 105, 192
XapI RAATTY 2 cut(s) 35, 76
XspI CTAG 1 cut(s) 53
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.