Rh1BG110600

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1B
Physical Location & Seq
Forward (+)
19014238 .. 19015464
1227 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1BG110600.1

Sequence Viewer

Length: 180 bp
ATGAGCCAGGAAGATTTGGACAGCAGCTTTGGTGGCTTTATTGAATGTGGAGCTGTCCGAGTAAATGGACTATTTTTGCATTGTCAAGTGGCCAGAAGAAGACCTGAAACTGATCTTGTTCTTGAAATGAGCACAAAACACCCGAAGGGTAAAGGGCGAGGGGTGGCAACAGAGAGATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

59

Amino Acids

6.52

Weight (kDa)

7.85

Isoelectric Point (pI)

74.14

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0019352)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr1g0334111
rosa_roxburghii Rroxscaffold_4G00316170
rosa_samantha Rh1AG135200 Rh1AG136500 Rh1AG136700 Rh1BG110600 Rh1CG128900
rosa_wichuraiana Rw1G011360

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 90
AgsI TTSAA 2 cut(s) 44, 125
AjnI CCWGG 1 cut(s) 6
AluBI AGCT 2 cut(s) 27, 53
AluI AGCT 2 cut(s) 27, 53
Alw21I GWGCWC 1 cut(s) 134
AoxI GGCC 1 cut(s) 90
ApeKI GCWGC 1 cut(s) 24
ArsI GACNNNNNNTTYG 2 cut(s) 11, 43
BalI TGGCCA 1 cut(s) 92
BbsI GAAGAC 1 cut(s) 106
Bbv12I GWGCWC 1 cut(s) 134
BbvI GCAGC 1 cut(s) 36
BciT130I CCWGG 1 cut(s) 8
BisI GCNGC 1 cut(s) 25
BlsI GCNGC 1 cut(s) 26
Bme1390I CCNGG 1 cut(s) 8
BmrFI CCNGG 1 cut(s) 8
BpiI GAAGAC 1 cut(s) 106
BseBI CCWGG 1 cut(s) 8
BseXI GCAGC 1 cut(s) 36
BshFI GGCC 1 cut(s) 92
BsiHKAI GWGCWC 1 cut(s) 134
BsnI GGCC 1 cut(s) 92
Bsp1286I GDGCHC 1 cut(s) 134
Bsp143I GATC 1 cut(s) 112
BspANI GGCC 1 cut(s) 92
BssMI GATC 1 cut(s) 112
Bst2UI CCWGG 1 cut(s) 8
BstKTI GATC 1 cut(s) 115
BstMBI GATC 1 cut(s) 112
BstMWI GCNNNNNNNGC 1 cut(s) 33
BstNI CCWGG 1 cut(s) 8
BstSCI CCNGG 1 cut(s) 6
BstV1I GCAGC 1 cut(s) 36
BstV2I GAAGAC 1 cut(s) 106
BsuRI GGCC 1 cut(s) 92
CviJI RGCY 5 cut(s) 6, 27, 36, 53, 92
CviKI_1 RGCY 5 cut(s) 6, 27, 36, 53, 92
DpnI GATC 1 cut(s) 114
DpnII GATC 1 cut(s) 112
EaeI YGGCCR 1 cut(s) 90
EcoRII CCWGG 1 cut(s) 6
Fnu4HI GCNGC 1 cut(s) 25
Fsp4HI GCNGC 1 cut(s) 25
GluI GCNGC 1 cut(s) 25
HaeIII GGCC 1 cut(s) 92
Hpy188I TCNGA 1 cut(s) 59
Hpy188III TCNNGA 1 cut(s) 122
HpyAV CCTTC 1 cut(s) 139
HpyCH4V TGCA 1 cut(s) 79
HpyF10VI GCNNNNNNNGC 1 cut(s) 33
Kzo9I GATC 1 cut(s) 112
LmnI GCTCC 1 cut(s) 50
LpnPI CCDG 3 cut(s) 20, 106, 117
Lsp1109I GCAGC 1 cut(s) 36
MalI GATC 1 cut(s) 114
MboI GATC 1 cut(s) 112
MboII GAAGA 3 cut(s) 23, 108, 111
MhlI GDGCHC 1 cut(s) 134
MlsI TGGCCA 1 cut(s) 92
MluNI TGGCCA 1 cut(s) 92
MnlI CCTC 1 cut(s) 152
Mox20I TGGCCA 1 cut(s) 92
MscI TGGCCA 1 cut(s) 92
Msp20I TGGCCA 1 cut(s) 92
MspR9I CCNGG 1 cut(s) 8
MvaI CCWGG 1 cut(s) 8
MwoI GCNNNNNNNGC 1 cut(s) 33
NdeII GATC 1 cut(s) 112
PkrI GCNGC 1 cut(s) 26
Psp6I CCWGG 1 cut(s) 6
PspGI CCWGG 1 cut(s) 6
SatI GCNGC 1 cut(s) 25
Sau3AI GATC 1 cut(s) 112
ScrFI CCNGG 1 cut(s) 8
SduI GDGCHC 1 cut(s) 134
SetI ASST 3 cut(s) 29, 55, 106
StyD4I CCNGG 1 cut(s) 6
TseI GCWGC 1 cut(s) 24
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.