Rh1BG230100

Oxidation resistance protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1B
Physical Location & Seq
Forward (+)
35154200 .. 35154813
614 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1BG230100.1

Sequence Viewer

Length: 234 bp
ATGGGTAGGCCAAGGAGTCTTCGCAGCAAAGCTGCCCACTTTGTGACTGATATCACTACTGGATTGCTCAACCCCATTTCTGACAAACCCTCCAAACCCTCTCCTTCTCCTCCTCCTGAAGATGTGGATGGGTCCAGAGTAAATCAAAATGGAACAATGAGTGAAGAGATGCCAGCTAATCCAGTTGATGGGCCTGACACTTCTTCATTTACTGCATTTCTCTACTCACTGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

77

Amino Acids

8.22

Weight (kDa)

5.07

Isoelectric Point (pI)

62.81

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 188
AcuI CTGAAG 1 cut(s) 138
AdeI CACNNNGTG 1 cut(s) 43
AfiI CCNNNNNNNGG 1 cut(s) 188
AluBI AGCT 2 cut(s) 32, 176
AluI AGCT 2 cut(s) 32, 176
AoxI GGCC 2 cut(s) 8, 191
ApeKI GCWGC 2 cut(s) 24, 32
AspS9I GGNCC 2 cut(s) 132, 191
AvaII GGWCC 1 cut(s) 132
BbsI GAAGAC 1 cut(s) 11
BbvI GCAGC 2 cut(s) 19, 36
BccI CCATC 2 cut(s) 122, 182
BisI GCNGC 2 cut(s) 25, 33
BlsI GCNGC 2 cut(s) 26, 34
Bme18I GGWCC 1 cut(s) 132
BmgT120I GGNCC 2 cut(s) 132, 191
BmiI GGNNCC 1 cut(s) 133
BmsI GCATC 1 cut(s) 159
BpiI GAAGAC 1 cut(s) 11
BsaJI CCNNGG 1 cut(s) 11
BsaXI ACNNNNNCTCC 2 cut(s) 74, 104
Bsc4I CCNNNNNNNGG 1 cut(s) 188
Bse1I ACTGG 2 cut(s) 64, 182
BseDI CCNNGG 1 cut(s) 11
BseGI GGATG 1 cut(s) 133
BseLI CCNNNNNNNGG 1 cut(s) 188
BseNI ACTGG 2 cut(s) 64, 182
BseRI GAGGAG 2 cut(s) 99, 102
BseXI GCAGC 2 cut(s) 19, 36
BshFI GGCC 2 cut(s) 10, 193
BslI CCNNNNNNNGG 1 cut(s) 188
BsnI GGCC 2 cut(s) 10, 193
BspANI GGCC 2 cut(s) 10, 193
BspLI GGNNCC 1 cut(s) 133
BsrI ACTGG 2 cut(s) 64, 182
BssECI CCNNGG 1 cut(s) 11
BssT1I CCWWGG 1 cut(s) 11
Bst4CI ACNGT 1 cut(s) 231
Bst6I CTCTTC 1 cut(s) 159
BstC8I GCNNGC 1 cut(s) 174
BstF5I GGATG 1 cut(s) 133
BstV1I GCAGC 2 cut(s) 19, 36
BstV2I GAAGAC 1 cut(s) 11
BsuRI GGCC 2 cut(s) 10, 193
BtsCI GGATG 1 cut(s) 133
BtsIMutI CAGTG 1 cut(s) 227
Cac8I GCNNGC 1 cut(s) 174
Cfr13I GGNCC 2 cut(s) 132, 191
CviJI RGCY 4 cut(s) 10, 32, 176, 193
CviKI_1 RGCY 4 cut(s) 10, 32, 176, 193
DraIII CACNNNGTG 1 cut(s) 43
Eam1104I CTCTTC 1 cut(s) 159
EarI CTCTTC 1 cut(s) 159
Eco130I CCWWGG 1 cut(s) 11
Eco32I GATATC 1 cut(s) 52
Eco47I GGWCC 1 cut(s) 132
Eco57I CTGAAG 1 cut(s) 138
EcoRV GATATC 1 cut(s) 52
EcoT14I CCWWGG 1 cut(s) 11
ErhI CCWWGG 1 cut(s) 11
Fnu4HI GCNGC 2 cut(s) 25, 33
FokI GGATG 1 cut(s) 140
Fsp4HI GCNGC 2 cut(s) 25, 33
GluI GCNGC 2 cut(s) 25, 33
HaeIII GGCC 2 cut(s) 10, 193
HinfI GANTC 1 cut(s) 16
Hpy188I TCNGA 1 cut(s) 82
Hpy188III TCNNGA 2 cut(s) 116, 135
HpyAV CCTTC 1 cut(s) 114
HpyCH4III ACNGT 1 cut(s) 231
HpyCH4V TGCA 1 cut(s) 215
LpnPI CCDG 6 cut(s) 45, 129, 148, 186, 195, 207
Lsp1109I GCAGC 2 cut(s) 19, 36
LweI GCATC 1 cut(s) 159
MaeIII GTNAC 1 cut(s) 43
MboII GAAGA 4 cut(s) 11, 131, 176, 195
MlyI GAGTC 1 cut(s) 25
MnlI CCTC 4 cut(s) 100, 109, 120, 123
NlaIV GGNNCC 1 cut(s) 133
NmuCI GTSAC 1 cut(s) 43
PflMI CCANNNNNTGG 1 cut(s) 188
PkrI GCNGC 2 cut(s) 26, 34
PleI GAGTC 1 cut(s) 24
PpsI GAGTC 1 cut(s) 24
PspN4I GGNNCC 1 cut(s) 133
PspPI GGNCC 2 cut(s) 132, 191
SatI GCNGC 2 cut(s) 25, 33
Sau96I GGNCC 2 cut(s) 132, 191
SchI GAGTC 1 cut(s) 25
SetI ASST 2 cut(s) 34, 178
SfaNI GCATC 1 cut(s) 159
SgeI CNNG 7 cut(s) 24, 72, 128, 147, 185, 194, 206
SinI GGWCC 1 cut(s) 132
StyI CCWWGG 1 cut(s) 11
TaaI ACNGT 1 cut(s) 231
TscAI CASTG 1 cut(s) 234
TseFI GTSAC 1 cut(s) 43
TseI GCWGC 2 cut(s) 24, 32
Tsp45I GTSAC 1 cut(s) 43
TspDTI ATGAA 1 cut(s) 195
TspRI CASTG 1 cut(s) 234
Van91I CCANNNNNTGG 1 cut(s) 188
VpaK11BI GGWCC 1 cut(s) 132
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.