Rh2DG252400

Oxidation resistance protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2D
Physical Location & Seq
Reverse (-)
26139353 .. 26139971
619 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2DG252400.1

Sequence Viewer

Length: 204 bp
ATGGGTTGGCGAAGGAGTCTTCGCAACAAATCGGCCCACTTTGTGACTGATATCACTACTGGATTGCTCAACCCCATTTCTGACAAACCCTCCAAACCCTCTCCTTCTCCTCCTCCTCAGGAAGATGAGGATGGGTCCAAAGGAAGTCAAAATGGAACAATGAGTGAAGAGAGTCCAGCTAATCCAGTTGTGTTGAGGCATTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

67

Amino Acids

7.27

Weight (kDa)

6.71

Isoelectric Point (pI)

97.64

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AdeI CACNNNGTG 1 cut(s) 43
AluBI AGCT 1 cut(s) 179
AluI AGCT 1 cut(s) 179
AoxI GGCC 1 cut(s) 33
AspS9I GGNCC 2 cut(s) 34, 135
AvaII GGWCC 1 cut(s) 135
AxyI CCTNAGG 1 cut(s) 117
BbsI GAAGAC 1 cut(s) 11
BccI CCATC 1 cut(s) 125
Bme18I GGWCC 1 cut(s) 135
BmgT120I GGNCC 2 cut(s) 34, 135
BmiI GGNNCC 1 cut(s) 136
BpiI GAAGAC 1 cut(s) 11
BsaXI ACNNNNNCTCC 2 cut(s) 74, 104
Bse1I ACTGG 2 cut(s) 64, 185
Bse21I CCTNAGG 1 cut(s) 117
BseGI GGATG 1 cut(s) 136
BseMII CTCAG 1 cut(s) 131
BseNI ACTGG 2 cut(s) 64, 185
BseRI GAGGAG 3 cut(s) 99, 102, 105
BshFI GGCC 1 cut(s) 35
BsnI GGCC 1 cut(s) 35
BspANI GGCC 1 cut(s) 35
BspCNI CTCAG 1 cut(s) 130
BspLI GGNNCC 1 cut(s) 136
BsrI ACTGG 2 cut(s) 64, 185
Bst6I CTCTTC 1 cut(s) 162
BstDEI CTNAG 1 cut(s) 117
BstF5I GGATG 1 cut(s) 136
BstV2I GAAGAC 1 cut(s) 11
Bsu36I CCTNAGG 1 cut(s) 117
BsuRI GGCC 1 cut(s) 35
BtsCI GGATG 1 cut(s) 136
Cfr13I GGNCC 2 cut(s) 34, 135
CviJI RGCY 2 cut(s) 35, 179
CviKI_1 RGCY 2 cut(s) 35, 179
DdeI CTNAG 1 cut(s) 117
DraIII CACNNNGTG 1 cut(s) 43
Eam1104I CTCTTC 1 cut(s) 162
EarI CTCTTC 1 cut(s) 162
Eco32I GATATC 1 cut(s) 52
Eco47I GGWCC 1 cut(s) 135
Eco81I CCTNAGG 1 cut(s) 117
EcoRV GATATC 1 cut(s) 52
FokI GGATG 1 cut(s) 143
HaeIII GGCC 1 cut(s) 35
HinfI GANTC 2 cut(s) 16, 172
Hpy188I TCNGA 1 cut(s) 82
Hpy188III TCNNGA 1 cut(s) 119
HpyAV CCTTC 2 cut(s) 6, 114
HpyF3I CTNAG 1 cut(s) 117
LpnPI CCDG 4 cut(s) 45, 104, 189, 198
MaeIII GTNAC 1 cut(s) 43
MboII GAAGA 3 cut(s) 11, 134, 179
MlyI GAGTC 2 cut(s) 25, 181
MnlI CCTC 7 cut(s) 100, 109, 120, 121, 123, 126, 189
NlaIV GGNNCC 1 cut(s) 136
NmuCI GTSAC 1 cut(s) 43
PleI GAGTC 2 cut(s) 24, 180
PpsI GAGTC 2 cut(s) 24, 180
PspN4I GGNNCC 1 cut(s) 136
PspPI GGNCC 2 cut(s) 34, 135
Sau96I GGNCC 2 cut(s) 34, 135
SchI GAGTC 2 cut(s) 25, 181
SetI ASST 1 cut(s) 181
SgeI CNNG 4 cut(s) 72, 131, 188, 197
SinI GGWCC 1 cut(s) 135
TseFI GTSAC 1 cut(s) 43
Tsp45I GTSAC 1 cut(s) 43
VpaK11BI GGWCC 1 cut(s) 135
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.