Rh1CG375900

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1C
Physical Location & Seq
Forward (+)
64472878 .. 64473158
281 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1CG375900.1

Sequence Viewer

Length: 210 bp
ATGAAGGCAAACATTCCCATTTCCAAGTACGCATCATTGGTTGGGATGATATGGAAACTGACTACCCTAGACATGAGATGTATGGACATCATTGTGTTGAATTATTCATGGGAATTAACAGGAGACGAAGTCAAAGCGATGGTAATTTCCTCTGGATCCTCTGCTGATGGACAGGAAAATGAAGCTAGAGTCATTGTGATTTCATCCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

69

Amino Acids

7.58

Weight (kDa)

4.77

Isoelectric Point (pI)

26.23

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018879)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 150, 163
AfaI GTAC 1 cut(s) 29
AgsI TTSAA 1 cut(s) 100
AluBI AGCT 1 cut(s) 185
AluI AGCT 1 cut(s) 185
Alw26I GTCTC 1 cut(s) 117
AlwI GGATC 2 cut(s) 150, 163
BamHI GGATCC 1 cut(s) 155
BccI CCATC 2 cut(s) 133, 161
BcoDI GTCTC 1 cut(s) 117
BfaI CTAG 2 cut(s) 68, 186
BmiI GGNNCC 1 cut(s) 157
BmsI GCATC 1 cut(s) 41
BsaXI ACNNNNNCTCC 2 cut(s) 114, 144
BseGI GGATG 2 cut(s) 51, 203
BsmAI GTCTC 1 cut(s) 117
BsmBI CGTCTC 1 cut(s) 117
Bsp143I GATC 1 cut(s) 155
BspLI GGNNCC 1 cut(s) 157
BspPI GGATC 2 cut(s) 150, 163
BssMI GATC 1 cut(s) 155
BstF5I GGATG 2 cut(s) 51, 203
BstKTI GATC 1 cut(s) 158
BstMAI GTCTC 1 cut(s) 117
BstMBI GATC 1 cut(s) 155
BstX2I RGATCY 1 cut(s) 155
BstYI RGATCY 1 cut(s) 155
BtgZI GCGATG 1 cut(s) 152
BtsCI GGATG 2 cut(s) 51, 203
Csp6I GTAC 1 cut(s) 28
CviAII CATG 2 cut(s) 73, 108
CviJI RGCY 1 cut(s) 185
CviKI_1 RGCY 1 cut(s) 185
CviQI GTAC 1 cut(s) 28
DpnI GATC 1 cut(s) 157
DpnII GATC 1 cut(s) 155
Esp3I CGTCTC 1 cut(s) 117
FaeI CATG 2 cut(s) 76, 111
FaiI YATR 4 cut(s) 52, 74, 83, 109
FatI CATG 2 cut(s) 72, 107
FokI GGATG 2 cut(s) 58, 190
FspBI CTAG 2 cut(s) 68, 186
Hin1II CATG 2 cut(s) 76, 111
HinfI GANTC 1 cut(s) 189
Hpy188III TCNNGA 2 cut(s) 153, 207
Hsp92II CATG 2 cut(s) 76, 111
Kzo9I GATC 1 cut(s) 155
LpnPI CCDG 3 cut(s) 105, 138, 158
LweI GCATC 1 cut(s) 41
MaeI CTAG 2 cut(s) 68, 186
MalI GATC 1 cut(s) 157
MboI GATC 1 cut(s) 155
MflI RGATCY 1 cut(s) 155
MluCI AATT 3 cut(s) 100, 113, 144
MlyI GAGTC 1 cut(s) 198
MnlI CCTC 2 cut(s) 160, 169
MseI TTAA 1 cut(s) 116
MslI CAYNNNNRTG 1 cut(s) 92
NdeII GATC 1 cut(s) 155
NlaIII CATG 2 cut(s) 76, 111
NlaIV GGNNCC 1 cut(s) 157
PflFI GACNNNGTC 1 cut(s) 128
PleI GAGTC 1 cut(s) 197
PpsI GAGTC 1 cut(s) 197
PspN4I GGNNCC 1 cut(s) 157
PsuI RGATCY 1 cut(s) 155
PsyI GACNNNGTC 1 cut(s) 128
RsaI GTAC 1 cut(s) 29
RsaNI GTAC 1 cut(s) 28
RseI CAYNNNNRTG 1 cut(s) 92
SaqAI TTAA 1 cut(s) 116
Sau3AI GATC 1 cut(s) 155
SchI GAGTC 1 cut(s) 198
SetI ASST 1 cut(s) 187
SfaNI GCATC 1 cut(s) 41
SgeI CNNG 8 cut(s) 37, 80, 85, 120, 132, 165, 185, 198
SmiMI CAYNNNNRTG 1 cut(s) 92
Sse9I AATT 3 cut(s) 100, 113, 144
SspMI CTAG 2 cut(s) 68, 186
TasI AATT 3 cut(s) 100, 113, 144
Tru1I TTAA 1 cut(s) 116
Tru9I TTAA 1 cut(s) 116
TspDTI ATGAA 4 cut(s) 17, 96, 192, 195
Tth111I GACNNNGTC 1 cut(s) 128
XspI CTAG 2 cut(s) 68, 186
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.