Rh1DG439100

Deoxynucleoside triphosphate triphosphohydrolase SAMHD1 homolog

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1D
Physical Location & Seq
Forward (+)
64940823 .. 64941776
954 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1DG439100.1

Sequence Viewer

Length: 198 bp
ATGGTCGTCTCCTCCTCAAAGAAGCTGAACGAGTTGATGGTGAGGGATGTTGGTTTCAGGACCCTGGCGTTCTCGATCTGGATAAGGTTTGATTATCTTGTCTATGACAGCCGAGCTTGTGGGCTGGGAGGCAACTTTGAGTTTAAAAGGTTGGATGAACTAAAGTTAAAGTTTAAAAGCTCCCTCCAGAGTGAGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

65

Amino Acids

7.57

Weight (kDa)

9.3

Isoelectric Point (pI)

42.68

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0019725)

Species Orthologous Gene IDs
fragaria_vesca FvH4_7g04560
pyrus_communis pycom111g05600
rosa_chinensis RchiOBHm_Chr5g0037401
rosa_roxburghii Rroxscaffold_2G00140170
rosa_rugosa Rorug04G0089900
rosa_samantha Rh1BG408000 Rh1DG439100

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AjnI CCWGG 1 cut(s) 63
AluBI AGCT 3 cut(s) 25, 116, 180
AluI AGCT 3 cut(s) 25, 116, 180
Alw26I GTCTC 1 cut(s) 13
AspS9I GGNCC 1 cut(s) 60
AsuHPI GGTGA 1 cut(s) 52
AvaII GGWCC 1 cut(s) 60
BccI CCATC 1 cut(s) 31
BciT130I CCWGG 1 cut(s) 65
BcoDI GTCTC 1 cut(s) 13
Bme1390I CCNGG 1 cut(s) 65
Bme18I GGWCC 1 cut(s) 60
BmgT120I GGNCC 1 cut(s) 60
BmiI GGNNCC 1 cut(s) 62
BmrFI CCNGG 1 cut(s) 65
BpmI CTGGAG 1 cut(s) 170
BsaJI CCNNGG 1 cut(s) 63
BseBI CCWGG 1 cut(s) 65
BseDI CCNNGG 1 cut(s) 63
BseGI GGATG 2 cut(s) 52, 160
BseRI GAGGAG 1 cut(s) 4
BseYI CCCAGC 1 cut(s) 124
BsmAI GTCTC 1 cut(s) 13
BsmBI CGTCTC 1 cut(s) 13
Bsp143I GATC 1 cut(s) 75
BspLI GGNNCC 1 cut(s) 62
BssECI CCNNGG 1 cut(s) 63
BssMI GATC 1 cut(s) 75
Bst2UI CCWGG 1 cut(s) 65
BstF5I GGATG 2 cut(s) 52, 160
BstKTI GATC 1 cut(s) 78
BstMAI GTCTC 1 cut(s) 13
BstMBI GATC 1 cut(s) 75
BstNI CCWGG 1 cut(s) 65
BstSCI CCNGG 1 cut(s) 63
BtsCI GGATG 2 cut(s) 52, 160
Cfr13I GGNCC 1 cut(s) 60
CviJI RGCY 5 cut(s) 25, 111, 116, 124, 180
CviKI_1 RGCY 5 cut(s) 25, 111, 116, 124, 180
DpnI GATC 1 cut(s) 77
DpnII GATC 1 cut(s) 75
DraI TTTAAA 2 cut(s) 145, 175
Eco47I GGWCC 1 cut(s) 60
EcoO109I RGGNCCY 1 cut(s) 60
EcoRII CCWGG 1 cut(s) 63
Esp3I CGTCTC 1 cut(s) 13
FaiI YATR 1 cut(s) 105
FokI GGATG 2 cut(s) 59, 167
GsaI CCCAGC 1 cut(s) 128
GsuI CTGGAG 1 cut(s) 170
HphI GGTGA 1 cut(s) 52
Hpy188III TCNNGA 4 cut(s) 58, 73, 79, 187
Kzo9I GATC 1 cut(s) 75
LmnI GCTCC 1 cut(s) 185
LpnPI CCDG 5 cut(s) 43, 50, 64, 77, 110
MalI GATC 1 cut(s) 77
MboI GATC 1 cut(s) 75
MmeI TCCRAC 1 cut(s) 132
MnlI CCTC 5 cut(s) 22, 25, 36, 122, 194
MseI TTAA 3 cut(s) 144, 167, 174
MspR9I CCNGG 1 cut(s) 65
MvaI CCWGG 1 cut(s) 65
NdeII GATC 1 cut(s) 75
NlaIV GGNNCC 1 cut(s) 62
NmeAIII GCCGAG 1 cut(s) 137
PpuMI RGGWCCY 1 cut(s) 60
Psp5II RGGWCCY 1 cut(s) 60
Psp6I CCWGG 1 cut(s) 63
PspFI CCCAGC 1 cut(s) 124
PspGI CCWGG 1 cut(s) 63
PspN4I GGNNCC 1 cut(s) 62
PspPI GGNCC 1 cut(s) 60
PspPPI RGGWCCY 1 cut(s) 60
SaqAI TTAA 3 cut(s) 144, 167, 174
Sau3AI GATC 1 cut(s) 75
Sau96I GGNCC 1 cut(s) 60
ScrFI CCNGG 1 cut(s) 65
SetI ASST 5 cut(s) 27, 89, 118, 152, 182
SinI GGWCC 1 cut(s) 60
StyD4I CCNGG 1 cut(s) 63
TaqI TCGA 1 cut(s) 74
Tru1I TTAA 3 cut(s) 144, 167, 174
Tru9I TTAA 3 cut(s) 144, 167, 174
TspDTI ATGAA 1 cut(s) 171
VpaK11BI GGWCC 1 cut(s) 60
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.