Rh2AG616300

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2A
Physical Location & Seq
Forward (+)
84086132 .. 84087136
1005 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2AG616300.1

Sequence Viewer

Length: 195 bp
ATGGGATTCAATGACTACTTGCCCAAAGGTCATGAGATAGCCCTTGAATCTGAAGATGCTGCTAGCAGATTTATAGCCCAGATAAAGGTTGCTGCCCTAGATGGCCATCCAGATTTGCTGGATGGGTTCGCTACATTTTTACAAGATTTTTCGCCAGCATCATCAACAAAGAACGTGCAGCAGAGTTCTACTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

64

Amino Acids

6.9

Weight (kDa)

4.5

Isoelectric Point (pI)

56.91

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0019127)

Species Orthologous Gene IDs
arabidopsis_thaliana AT5G15025
malus_domestica MD09G1041400.v1.1 MD15G1355900.v1.1
prunus_persica Prupe.3G276200_v2.0.a1 Prupe.3G276200_v2.0.a1
pyrus_communis pycom111g03240
rosa_laevigata RLG00000021909
rosa_samantha Rh2AG616300

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 103
AcuI CTGAAG 1 cut(s) 72
AfiI CCNNNNNNNGG 1 cut(s) 85
AgsI TTSAA 2 cut(s) 10, 47
AoxI GGCC 1 cut(s) 103
ApeKI GCWGC 3 cut(s) 59, 92, 178
AsuNHI GCTAGC 1 cut(s) 62
BalI TGGCCA 1 cut(s) 105
BbvI GCAGC 3 cut(s) 46, 79, 190
BccI CCATC 3 cut(s) 95, 114, 116
BfaI CTAG 2 cut(s) 63, 98
BisI GCNGC 3 cut(s) 60, 93, 179
BlsI GCNGC 3 cut(s) 61, 94, 180
BmsI GCATC 2 cut(s) 46, 167
BmtI GCTAGC 1 cut(s) 66
BsaBI GATNNNNATC 1 cut(s) 105
Bsc4I CCNNNNNNNGG 1 cut(s) 85
Bse8I GATNNNNATC 1 cut(s) 105
BseGI GGATG 2 cut(s) 106, 127
BseJI GATNNNNATC 1 cut(s) 105
BseLI CCNNNNNNNGG 1 cut(s) 85
BseXI GCAGC 3 cut(s) 46, 79, 190
BshFI GGCC 1 cut(s) 105
BslI CCNNNNNNNGG 1 cut(s) 85
BsnI GGCC 1 cut(s) 105
BspANI GGCC 1 cut(s) 105
BspHI TCATGA 1 cut(s) 31
BspOI GCTAGC 1 cut(s) 66
BstC8I GCNNGC 2 cut(s) 64, 156
BstDEI CTNAG 1 cut(s) 192
BstF5I GGATG 2 cut(s) 106, 127
BstV1I GCAGC 3 cut(s) 46, 79, 190
BsuRI GGCC 1 cut(s) 105
BtsCI GGATG 2 cut(s) 106, 127
Cac8I GCNNGC 2 cut(s) 64, 156
CciI TCATGA 1 cut(s) 31
CviAII CATG 1 cut(s) 32
CviJI RGCY 3 cut(s) 41, 77, 105
CviKI_1 RGCY 3 cut(s) 41, 77, 105
DdeI CTNAG 1 cut(s) 192
EaeI YGGCCR 1 cut(s) 103
Eco57I CTGAAG 1 cut(s) 72
FaeI CATG 1 cut(s) 35
FaiI YATR 2 cut(s) 33, 74
FatI CATG 1 cut(s) 31
Fnu4HI GCNGC 3 cut(s) 60, 93, 179
FokI GGATG 2 cut(s) 93, 134
Fsp4HI GCNGC 3 cut(s) 60, 93, 179
FspBI CTAG 2 cut(s) 63, 98
GluI GCNGC 3 cut(s) 60, 93, 179
HaeIII GGCC 1 cut(s) 105
Hin1II CATG 1 cut(s) 35
HinfI GANTC 2 cut(s) 6, 47
Hpy188I TCNGA 1 cut(s) 52
Hpy188III TCNNGA 2 cut(s) 32, 110
HpyCH4IV ACGT 1 cut(s) 174
HpyCH4V TGCA 1 cut(s) 178
HpyF3I CTNAG 1 cut(s) 192
HpySE526I ACGT 1 cut(s) 174
Hsp92II CATG 1 cut(s) 35
LpnPI CCDG 4 cut(s) 92, 104, 123, 168
Lsp1109I GCAGC 3 cut(s) 46, 79, 190
LweI GCATC 2 cut(s) 46, 167
MaeI CTAG 2 cut(s) 63, 98
MaeII ACGT 1 cut(s) 174
MboII GAAGA 1 cut(s) 65
MlsI TGGCCA 1 cut(s) 105
MluNI TGGCCA 1 cut(s) 105
Mox20I TGGCCA 1 cut(s) 105
MscI TGGCCA 1 cut(s) 105
Msp20I TGGCCA 1 cut(s) 105
NheI GCTAGC 1 cut(s) 62
NlaIII CATG 1 cut(s) 35
PagI TCATGA 1 cut(s) 31
PfeI GAWTC 2 cut(s) 6, 47
PkrI GCNGC 3 cut(s) 61, 94, 180
SatI GCNGC 3 cut(s) 60, 93, 179
SetI ASST 3 cut(s) 31, 90, 177
SfaNI GCATC 2 cut(s) 46, 167
SspMI CTAG 2 cut(s) 63, 98
TaiI ACGT 1 cut(s) 177
TfiI GAWTC 2 cut(s) 6, 47
TseI GCWGC 3 cut(s) 59, 92, 178
XspI CTAG 2 cut(s) 63, 98
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.