Rh2BG024300

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2B
Physical Location & Seq
Forward (+)
1632616 .. 1633380
765 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2BG024300.1

Sequence Viewer

Length: 432 bp
ATGGCCTCAAAATCACACATCTCCTTGAATCGTACATGTCTATGTTCACCTACAGAACATCCAGGTTCTTTCAGGTGCAGTTTGCACAGAAGTAATGTGAATAATAGGCAGGCTACAATTAGCAGTAGTAGACCTGCAAAAGACGTTGTAAAACCAAATTCGATAAAAGAAATCCTTCTCCAAACTATCAAGCCCTCGTCTAGTCAGGATCTTCAAAGAAGGAGAAAGTTCCAGCCAAAGCCTAGCAGGTTTTGCTTGCTTGTTCATCATTTTGCCACAAATAATTGTGTCAAACGAGCAACAATGCAGACAAAGAATGTGATGAACAAGCAACAATGGAGGCTAGAGTTGTTCTGCATATGCATATATCATAACAACATTGACAAATTTGATCCATCCCCACCTTACCCACAGATCGTCAAAACAATATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

143

Amino Acids

16.5

Weight (kDa)

10.16

Isoelectric Point (pI)

71.22

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0019647)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g01920
prunus_persica Prupe.7G256800_v2.0.a1
rosa_chinensis RchiOBHm_Chr2g0086941
rosa_roxburghii Rroxscaffold_2G00153990
rosa_samantha Rh2AG023600 Rh2BG024300 Rh2CG024500

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 2 cut(s) 142, 237
AccI GTMKAC 1 cut(s) 130
AclWI GGATC 2 cut(s) 216, 386
AcsI RAATTY 2 cut(s) 157, 386
AfaI GTAC 1 cut(s) 34
AflIII ACRYGT 1 cut(s) 35
AgsI TTSAA 2 cut(s) 28, 215
AjnI CCWGG 1 cut(s) 61
AlwI GGATC 2 cut(s) 216, 386
AoxI GGCC 1 cut(s) 3
ApoI RAATTY 2 cut(s) 157, 386
Asp700I GAANNNNTTC 1 cut(s) 174
AsuHPI GGTGA 1 cut(s) 39
BccI CCATC 1 cut(s) 403
BciT130I CCWGG 1 cut(s) 63
BfaI CTAG 3 cut(s) 201, 243, 344
BfmI CTRYAG 1 cut(s) 51
BfuAI ACCTGC 2 cut(s) 142, 237
Bme1390I CCNGG 1 cut(s) 63
BmrFI CCNGG 1 cut(s) 63
BseBI CCWGG 1 cut(s) 63
BseGI GGATG 2 cut(s) 58, 395
BsgI GTGCAG 1 cut(s) 97
BshFI GGCC 1 cut(s) 5
BsnI GGCC 1 cut(s) 5
Bsp143I GATC 3 cut(s) 208, 391, 414
BspANI GGCC 1 cut(s) 5
BspMI ACCTGC 2 cut(s) 142, 237
BspPI GGATC 2 cut(s) 216, 386
BssMI GATC 3 cut(s) 208, 391, 414
Bst2UI CCWGG 1 cut(s) 63
BstAPI GCANNNNNTGC 1 cut(s) 252
BstC8I GCNNGC 2 cut(s) 111, 257
BstF5I GGATG 2 cut(s) 58, 395
BstKTI GATC 3 cut(s) 211, 394, 417
BstMBI GATC 3 cut(s) 208, 391, 414
BstMWI GCNNNNNNNGC 1 cut(s) 252
BstNI CCWGG 1 cut(s) 63
BstNSI RCATGY 1 cut(s) 39
BstSCI CCNGG 1 cut(s) 61
BstSFI CTRYAG 1 cut(s) 51
BstX2I RGATCY 1 cut(s) 208
BstYI RGATCY 1 cut(s) 208
BsuRI GGCC 1 cut(s) 5
BtsCI GGATG 2 cut(s) 58, 395
BveI ACCTGC 2 cut(s) 142, 237
Cac8I GCNNGC 2 cut(s) 111, 257
Csp6I GTAC 1 cut(s) 33
CviAII CATG 1 cut(s) 36
CviJI RGCY 6 cut(s) 5, 113, 193, 235, 241, 343
CviKI_1 RGCY 6 cut(s) 5, 113, 193, 235, 241, 343
CviQI GTAC 1 cut(s) 33
DpnI GATC 3 cut(s) 210, 393, 416
DpnII GATC 3 cut(s) 208, 391, 414
EcoRII CCWGG 1 cut(s) 61
EcoT22I ATGCAT 1 cut(s) 365
FaeI CATG 1 cut(s) 39
FaiI YATR 8 cut(s) 37, 43, 359, 361, 365, 367, 372, 430
FalI AAGNNNNNCTT 2 cut(s) 159, 191
FatI CATG 1 cut(s) 35
FauNDI CATATG 1 cut(s) 359
FblI GTMKAC 1 cut(s) 130
FokI GGATG 2 cut(s) 45, 382
FspBI CTAG 3 cut(s) 201, 243, 344
HaeIII GGCC 1 cut(s) 5
Hin1II CATG 1 cut(s) 39
HinfI GANTC 1 cut(s) 28
HphI GGTGA 1 cut(s) 39
Hpy166II GTNNAC 2 cut(s) 47, 131
Hpy188III TCNNGA 1 cut(s) 206
Hpy8I GTNNAC 2 cut(s) 47, 131
HpyAV CCTTC 2 cut(s) 185, 213
HpyCH4IV ACGT 1 cut(s) 144
HpyCH4V TGCA 6 cut(s) 78, 85, 137, 307, 357, 363
HpyF10VI GCNNNNNNNGC 1 cut(s) 252
HpySE526I ACGT 1 cut(s) 144
Hsp92II CATG 1 cut(s) 39
Kzo9I GATC 3 cut(s) 208, 391, 414
LpnPI CCDG 8 cut(s) 48, 58, 75, 95, 147, 191, 232, 245
MaeI CTAG 3 cut(s) 201, 243, 344
MaeII ACGT 1 cut(s) 144
MalI GATC 3 cut(s) 210, 393, 416
MboI GATC 3 cut(s) 208, 391, 414
MboII GAAGA 1 cut(s) 203
MflI RGATCY 1 cut(s) 208
MluCI AATT 4 cut(s) 117, 157, 283, 386
MnlI CCTC 3 cut(s) 16, 205, 333
Mph1103I ATGCAT 1 cut(s) 365
MroXI GAANNNNTTC 1 cut(s) 174
MslI CAYNNNNRTG 1 cut(s) 40
MspR9I CCNGG 1 cut(s) 63
MvaI CCWGG 1 cut(s) 63
MwoI GCNNNNNNNGC 1 cut(s) 252
NdeI CATATG 1 cut(s) 359
NdeII GATC 3 cut(s) 208, 391, 414
NlaIII CATG 1 cut(s) 39
NsiI ATGCAT 1 cut(s) 365
NspI RCATGY 1 cut(s) 39
PciI ACATGT 1 cut(s) 35
PdmI GAANNNNTTC 1 cut(s) 174
PfeI GAWTC 1 cut(s) 28
PscI ACATGT 1 cut(s) 35
Psp6I CCWGG 1 cut(s) 61
PspGI CCWGG 1 cut(s) 61
PsuI RGATCY 1 cut(s) 208
RsaI GTAC 1 cut(s) 34
RsaNI GTAC 1 cut(s) 33
RseI CAYNNNNRTG 1 cut(s) 40
Sau3AI GATC 3 cut(s) 208, 391, 414
ScrFI CCNGG 1 cut(s) 63
SetI ASST 7 cut(s) 52, 67, 77, 136, 147, 251, 406
SfcI CTRYAG 1 cut(s) 51
SmiMI CAYNNNNRTG 1 cut(s) 40
Sse9I AATT 4 cut(s) 117, 157, 283, 386
SspMI CTAG 3 cut(s) 201, 243, 344
StyD4I CCNGG 1 cut(s) 61
TaiI ACGT 1 cut(s) 147
TaqI TCGA 1 cut(s) 161
TasI AATT 4 cut(s) 117, 157, 283, 386
TfiI GAWTC 1 cut(s) 28
TspDTI ATGAA 2 cut(s) 254, 338
XapI RAATTY 2 cut(s) 157, 386
XceI RCATGY 1 cut(s) 39
XmiI GTMKAC 1 cut(s) 130
XmnI GAANNNNTTC 1 cut(s) 174
XspI CTAG 3 cut(s) 201, 243, 344
Zsp2I ATGCAT 1 cut(s) 365
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.