Rh2CG024500

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2C
Physical Location & Seq
Forward (+)
1866891 .. 1867406
516 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2CG024500.1

Sequence Viewer

Length: 288 bp
ATGGCCTCAAAATCACACATCTCCTTGAATCGTACATGTCTATGTTCACCTACAGAACATCCAGGTTCTTTCAGGTGCAGTTTGCACAGAAGTAATGTGAATAATAGGCAAGCTACAAGTAGCAGTAGTAGACCTGCAAAAGATGTTGTAAAACCAAATTCGATAAAAGAAATCCTTCTCCAAACTATCAAGCCCTCGTCTAGTCAGGATCTTCAAAGAAGGAGAAAGTTCCAGCCAAAGCCTAGCAGAAAGCATAAGAAATTAGAGATTAATTTACTCTACGTTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

95

Amino Acids

10.82

Weight (kDa)

10.8

Isoelectric Point (pI)

80.57

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0019647)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g01920
prunus_persica Prupe.7G256800_v2.0.a1
rosa_chinensis RchiOBHm_Chr2g0086941
rosa_roxburghii Rroxscaffold_2G00153990
rosa_samantha Rh2AG023600 Rh2BG024300 Rh2CG024500

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 142
AccI GTMKAC 1 cut(s) 130
AclWI GGATC 1 cut(s) 216
AcsI RAATTY 1 cut(s) 157
AfaI GTAC 1 cut(s) 34
AflIII ACRYGT 1 cut(s) 35
AgsI TTSAA 2 cut(s) 28, 215
AjnI CCWGG 1 cut(s) 61
AluBI AGCT 1 cut(s) 113
AluI AGCT 1 cut(s) 113
AlwI GGATC 1 cut(s) 216
AoxI GGCC 1 cut(s) 3
ApoI RAATTY 1 cut(s) 157
AseI ATTAAT 1 cut(s) 270
Asp700I GAANNNNTTC 1 cut(s) 174
AsuHPI GGTGA 1 cut(s) 39
BciT130I CCWGG 1 cut(s) 63
BfaI CTAG 2 cut(s) 201, 243
BfmI CTRYAG 1 cut(s) 51
BfuAI ACCTGC 1 cut(s) 142
Bme1390I CCNGG 1 cut(s) 63
BmrFI CCNGG 1 cut(s) 63
BseBI CCWGG 1 cut(s) 63
BseGI GGATG 1 cut(s) 58
BsgI GTGCAG 1 cut(s) 97
BshFI GGCC 1 cut(s) 5
BsnI GGCC 1 cut(s) 5
Bsp143I GATC 1 cut(s) 208
BspANI GGCC 1 cut(s) 5
BspMI ACCTGC 1 cut(s) 142
BspPI GGATC 1 cut(s) 216
BssMI GATC 1 cut(s) 208
Bst2UI CCWGG 1 cut(s) 63
BstC8I GCNNGC 1 cut(s) 111
BstF5I GGATG 1 cut(s) 58
BstKTI GATC 1 cut(s) 211
BstMBI GATC 1 cut(s) 208
BstNI CCWGG 1 cut(s) 63
BstNSI RCATGY 1 cut(s) 39
BstSCI CCNGG 1 cut(s) 61
BstSFI CTRYAG 1 cut(s) 51
BstX2I RGATCY 1 cut(s) 208
BstYI RGATCY 1 cut(s) 208
BsuRI GGCC 1 cut(s) 5
BtsCI GGATG 1 cut(s) 58
BveI ACCTGC 1 cut(s) 142
Cac8I GCNNGC 1 cut(s) 111
Csp6I GTAC 1 cut(s) 33
CviAII CATG 1 cut(s) 36
CviJI RGCY 5 cut(s) 5, 113, 193, 235, 241
CviKI_1 RGCY 5 cut(s) 5, 113, 193, 235, 241
CviQI GTAC 1 cut(s) 33
DpnI GATC 1 cut(s) 210
DpnII GATC 1 cut(s) 208
EcoRII CCWGG 1 cut(s) 61
FaeI CATG 1 cut(s) 39
FaiI YATR 3 cut(s) 37, 43, 255
FalI AAGNNNNNCTT 2 cut(s) 159, 191
FatI CATG 1 cut(s) 35
FblI GTMKAC 1 cut(s) 130
FokI GGATG 1 cut(s) 45
FspBI CTAG 2 cut(s) 201, 243
HaeIII GGCC 1 cut(s) 5
Hin1II CATG 1 cut(s) 39
HinfI GANTC 1 cut(s) 28
HphI GGTGA 1 cut(s) 39
Hpy166II GTNNAC 2 cut(s) 47, 131
Hpy188III TCNNGA 1 cut(s) 206
Hpy8I GTNNAC 2 cut(s) 47, 131
HpyAV CCTTC 2 cut(s) 185, 213
HpyCH4IV ACGT 1 cut(s) 282
HpyCH4V TGCA 3 cut(s) 78, 85, 137
HpySE526I ACGT 1 cut(s) 282
Hsp92II CATG 1 cut(s) 39
Kzo9I GATC 1 cut(s) 208
LpnPI CCDG 6 cut(s) 48, 58, 75, 147, 191, 245
MaeI CTAG 2 cut(s) 201, 243
MaeII ACGT 1 cut(s) 282
MalI GATC 1 cut(s) 210
MboI GATC 1 cut(s) 208
MboII GAAGA 1 cut(s) 203
MflI RGATCY 1 cut(s) 208
MluCI AATT 3 cut(s) 157, 260, 271
MnlI CCTC 2 cut(s) 16, 205
MroXI GAANNNNTTC 1 cut(s) 174
MseI TTAA 1 cut(s) 270
MslI CAYNNNNRTG 1 cut(s) 40
MspR9I CCNGG 1 cut(s) 63
MvaI CCWGG 1 cut(s) 63
NdeII GATC 1 cut(s) 208
NlaIII CATG 1 cut(s) 39
NspI RCATGY 1 cut(s) 39
PciI ACATGT 1 cut(s) 35
PdmI GAANNNNTTC 1 cut(s) 174
PfeI GAWTC 1 cut(s) 28
PscI ACATGT 1 cut(s) 35
PshBI ATTAAT 1 cut(s) 270
Psp6I CCWGG 1 cut(s) 61
PspGI CCWGG 1 cut(s) 61
PsuI RGATCY 1 cut(s) 208
RsaI GTAC 1 cut(s) 34
RsaNI GTAC 1 cut(s) 33
RseI CAYNNNNRTG 1 cut(s) 40
SaqAI TTAA 1 cut(s) 270
Sau3AI GATC 1 cut(s) 208
ScrFI CCNGG 1 cut(s) 63
SetI ASST 6 cut(s) 52, 67, 77, 115, 136, 285
SfcI CTRYAG 1 cut(s) 51
SmiMI CAYNNNNRTG 1 cut(s) 40
Sse9I AATT 3 cut(s) 157, 260, 271
SspMI CTAG 2 cut(s) 201, 243
StyD4I CCNGG 1 cut(s) 61
TaiI ACGT 1 cut(s) 285
TaqI TCGA 1 cut(s) 161
TasI AATT 3 cut(s) 157, 260, 271
TfiI GAWTC 1 cut(s) 28
Tru1I TTAA 1 cut(s) 270
Tru9I TTAA 1 cut(s) 270
VspI ATTAAT 1 cut(s) 270
XapI RAATTY 1 cut(s) 157
XceI RCATGY 1 cut(s) 39
XmiI GTMKAC 1 cut(s) 130
XmnI GAANNNNTTC 1 cut(s) 174
XspI CTAG 2 cut(s) 201, 243
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.