Rh2DG261900

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2D
Physical Location & Seq
Forward (+)
28209136 .. 28209360
225 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2DG261900.1

Sequence Viewer

Length: 225 bp
ATGTTCTCCGCTGGTCTTAATGCGCGAAAGACGACCGTCGACCCCCAGACGAAGGAGGTCAGTCCCGCCGAGGCTGAGGTTGTCCTGGAGATGCCTCACCATTCCTACCTTCCCGCCACGGGGGAAACAGGTGTCCGCCCCACCGCTACTAATCTAAAGCGCGCGACGGTCGGAGGAAGCCGGCCGGAGAAGGCCGTGGAGAGGGCTTCTGGCTCCCGCGCGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

74

Amino Acids

7.8

Weight (kDa)

9.39

Isoelectric Point (pI)

41.31

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0021660)

Species Orthologous Gene IDs
rosa_multiflora Rmu_sc0002892.1_g000072 Rmu_sc0020206.1_g000002 Rmu_sc0020207.1_g000002
rosa_samantha Rh2DG261900
rosa_wichuraiana Rw2G013620

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 39
AccII CGCG 5 cut(s) 25, 162, 164, 219, 221
AciI CCGC 6 cut(s) 9, 66, 114, 136, 144, 217
AcoI YGGCCR 1 cut(s) 182
AfiI CCNNNNNNNGG 4 cut(s) 52, 119, 120, 201
AjnI CCWGG 1 cut(s) 84
AoxI GGCC 2 cut(s) 182, 192
AspLEI GCGC 4 cut(s) 25, 162, 164, 221
AsuHPI GGTGA 1 cut(s) 89
BbvCI CCTCAGC 1 cut(s) 75
BceAI ACGGC 1 cut(s) 179
BciT130I CCWGG 1 cut(s) 86
Bme1390I CCNGG 1 cut(s) 86
BmiI GGNNCC 1 cut(s) 214
BmrFI CCNGG 1 cut(s) 86
BmsI GCATC 1 cut(s) 81
BoxI GACNNNNGTC 1 cut(s) 35
BpmI CTGGAG 1 cut(s) 107
Bpu10I CCTNAGC 1 cut(s) 75
BsaJI CCNNGG 3 cut(s) 69, 117, 195
Bsc4I CCNNNNNNNGG 4 cut(s) 52, 119, 120, 201
Bse118I RCCGGY 1 cut(s) 180
BseBI CCWGG 1 cut(s) 86
BseDI CCNNGG 3 cut(s) 69, 117, 195
BseLI CCNNNNNNNGG 4 cut(s) 52, 119, 120, 201
BseMII CTCAG 1 cut(s) 66
BsePI GCGCGC 1 cut(s) 160
BseX3I CGGCCG 1 cut(s) 182
Bsh1236I CGCG 5 cut(s) 25, 162, 164, 219, 221
Bsh1285I CGRYCG 3 cut(s) 36, 171, 185
BshFI GGCC 2 cut(s) 184, 194
BsiEI CGRYCG 3 cut(s) 36, 171, 185
BsiSI CCGG 2 cut(s) 181, 185
BslFI GGGAC 1 cut(s) 48
BslI CCNNNNNNNGG 4 cut(s) 52, 119, 120, 201
BsmFI GGGAC 1 cut(s) 48
BsnI GGCC 2 cut(s) 184, 194
BspACI CCGC 6 cut(s) 9, 66, 114, 136, 144, 217
BspANI GGCC 2 cut(s) 184, 194
BspCNI CTCAG 1 cut(s) 67
BspFNI CGCG 5 cut(s) 25, 162, 164, 219, 221
BspLI GGNNCC 1 cut(s) 214
BsrFI RCCGGY 1 cut(s) 180
BssAI RCCGGY 1 cut(s) 180
BssECI CCNNGG 3 cut(s) 69, 117, 195
BssHII GCGCGC 1 cut(s) 160
Bst2UI CCWGG 1 cut(s) 86
Bst4CI ACNGT 2 cut(s) 37, 169
BstC8I GCNNGC 2 cut(s) 162, 182
BstDEI CTNAG 1 cut(s) 75
BstDSI CCRYGG 2 cut(s) 117, 195
BstFNI CGCG 5 cut(s) 25, 162, 164, 219, 221
BstHHI GCGC 4 cut(s) 25, 162, 164, 221
BstMCI CGRYCG 3 cut(s) 36, 171, 185
BstNI CCWGG 1 cut(s) 86
BstPAI GACNNNNGTC 1 cut(s) 35
BstSCI CCNGG 1 cut(s) 84
BstUI CGCG 5 cut(s) 25, 162, 164, 219, 221
BstZI CGGCCG 1 cut(s) 182
BsuRI GGCC 2 cut(s) 184, 194
BtgI CCRYGG 2 cut(s) 117, 195
Cac8I GCNNGC 2 cut(s) 162, 182
CfoI GCGC 4 cut(s) 25, 162, 164, 221
Cfr10I RCCGGY 1 cut(s) 180
CviJI RGCY 6 cut(s) 74, 180, 184, 194, 206, 213
CviKI_1 RGCY 6 cut(s) 74, 180, 184, 194, 206, 213
DdeI CTNAG 1 cut(s) 75
EaeI YGGCCR 1 cut(s) 182
EagI CGGCCG 1 cut(s) 182
EciI GGCGGA 1 cut(s) 125
EclXI CGGCCG 1 cut(s) 182
Eco52I CGGCCG 1 cut(s) 182
EcoRII CCWGG 1 cut(s) 84
FaqI GGGAC 1 cut(s) 48
FauI CCCGC 2 cut(s) 73, 121
FblI GTMKAC 1 cut(s) 39
GlaI GCGC 4 cut(s) 24, 161, 163, 220
GsuI CTGGAG 1 cut(s) 107
HaeIII GGCC 2 cut(s) 184, 194
HapII CCGG 2 cut(s) 181, 185
HhaI GCGC 4 cut(s) 25, 162, 164, 221
Hin6I GCGC 4 cut(s) 23, 160, 162, 219
HinP1I GCGC 4 cut(s) 23, 160, 162, 219
HincII GTYRAC 1 cut(s) 40
HindII GTYRAC 1 cut(s) 40
HpaII CCGG 2 cut(s) 181, 185
HphI GGTGA 1 cut(s) 89
Hpy166II GTNNAC 1 cut(s) 40
Hpy188I TCNGA 1 cut(s) 173
Hpy8I GTNNAC 1 cut(s) 40
Hpy99I CGWCG 2 cut(s) 41, 169
HpyAV CCTTC 3 cut(s) 46, 119, 184
HpyCH4III ACNGT 2 cut(s) 37, 169
HpyF3I CTNAG 1 cut(s) 75
HspAI GCGC 4 cut(s) 23, 160, 162, 219
KroI GCCGGC 1 cut(s) 180
KroNI GCCGGC 1 cut(s) 182
LmnI GCTCC 1 cut(s) 218
LpnPI CCDG 7 cut(s) 59, 71, 98, 114, 194, 195, 198
LweI GCATC 1 cut(s) 81
MmeI TCCRAC 1 cut(s) 151
MnlI CCTC 6 cut(s) 49, 64, 70, 105, 167, 195
MroNI GCCGGC 1 cut(s) 180
MseI TTAA 1 cut(s) 18
MspA1I CMGCKG 1 cut(s) 11
MspI CCGG 2 cut(s) 181, 185
MspR9I CCNGG 1 cut(s) 86
MvaI CCWGG 1 cut(s) 86
MvnI CGCG 5 cut(s) 25, 162, 164, 219, 221
NaeI GCCGGC 1 cut(s) 182
NgoMIV GCCGGC 1 cut(s) 180
NlaIV GGNNCC 1 cut(s) 214
NmeAIII GCCGAG 1 cut(s) 94
PauI GCGCGC 1 cut(s) 160
PdiI GCCGGC 1 cut(s) 182
PfoI TCCNGGA 1 cut(s) 84
PshAI GACNNNNGTC 1 cut(s) 35
Psp6I CCWGG 1 cut(s) 84
PspGI CCWGG 1 cut(s) 84
PspN4I GGNNCC 1 cut(s) 214
PteI GCGCGC 1 cut(s) 160
SalI GTCGAC 1 cut(s) 38
SaqAI TTAA 1 cut(s) 18
ScrFI CCNGG 1 cut(s) 86
SetI ASST 4 cut(s) 60, 81, 111, 133
SfaNI GCATC 1 cut(s) 81
SsiI CCGC 6 cut(s) 9, 66, 114, 136, 144, 217
StyD4I CCNGG 1 cut(s) 84
TaaI ACNGT 2 cut(s) 37, 169
TaqI TCGA 1 cut(s) 39
Tru1I TTAA 1 cut(s) 18
Tru9I TTAA 1 cut(s) 18
XmiI GTMKAC 1 cut(s) 39
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.