Rh3AG209800

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3A
Physical Location & Seq
Reverse (-)
21018903 .. 21023870
4968 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3AG209800.1

Sequence Viewer

Length: 393 bp
ATGGAGAACTCCATTGGTGTCGGATTCATGGCGGTTTTCGCTGTTTCTGGAAGCGTTGTTCTTCTTGCCCATCAAGTAAACAAGCGTCTTCTCTCTCATTTCATGAAGGATATTGAGTTTGAATTGGGTGGTTTGCTGTATAATCATCACCATGATCACCACAAGAGATTGGGTGGGTCTGAGAAAACCCAACAATGCAAGAAGATGGTTCGATTTGCAGATGATGTTGCGGAACCATCATCAAACAACAAAGAGTATCGCAAGAGGCGGATGACGAAGCAGACTAATGATGGTCATGGTGACAAAATTGAGAGCAACATGCCACTCAACAGGCAAGCTCTTTACAAAGGGATCATTGAGTTCAAGACCCTCAAGGGTCAGCACGTATATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

130

Amino Acids

14.89

Weight (kDa)

9.52

Isoelectric Point (pI)

44.75

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 3 cut(s) 32, 230, 268
AclWI GGATC 1 cut(s) 359
AgsI TTSAA 2 cut(s) 122, 364
AloI GAACNNNNNNTCC 2 cut(s) 42, 74
AluBI AGCT 1 cut(s) 338
AluI AGCT 1 cut(s) 338
AlwI GGATC 1 cut(s) 359
AsuHPI GGTGA 3 cut(s) 140, 149, 311
BbsI GAAGAC 1 cut(s) 80
BccI CCATC 4 cut(s) 78, 199, 244, 284
BclI TGATCA 1 cut(s) 154
BmiI GGNNCC 1 cut(s) 234
BpiI GAAGAC 1 cut(s) 80
BpuEI CTTGAG 1 cut(s) 356
BsaAI YACGTR 1 cut(s) 385
BseGI GGATG 1 cut(s) 276
BseMII CTCAG 1 cut(s) 171
Bsp143I GATC 2 cut(s) 154, 351
BspACI CCGC 3 cut(s) 32, 230, 268
BspCNI CTCAG 1 cut(s) 172
BspHI TCATGA 1 cut(s) 102
BspLI GGNNCC 1 cut(s) 234
BspPI GGATC 1 cut(s) 359
BssMI GATC 2 cut(s) 154, 351
BstBAI YACGTR 1 cut(s) 385
BstC8I GCNNGC 1 cut(s) 336
BstDEI CTNAG 1 cut(s) 180
BstF5I GGATG 1 cut(s) 276
BstKTI GATC 2 cut(s) 157, 354
BstMBI GATC 2 cut(s) 154, 351
BstMWI GCNNNNNNNGC 1 cut(s) 38
BstNSI RCATGY 1 cut(s) 322
BstV2I GAAGAC 1 cut(s) 80
BtsCI GGATG 1 cut(s) 276
Cac8I GCNNGC 1 cut(s) 336
CciI TCATGA 1 cut(s) 102
CseI GACGC 1 cut(s) 74
CviAII CATG 5 cut(s) 28, 103, 152, 296, 319
CviJI RGCY 1 cut(s) 338
CviKI_1 RGCY 1 cut(s) 338
DdeI CTNAG 1 cut(s) 180
DpnI GATC 2 cut(s) 156, 353
DpnII GATC 2 cut(s) 154, 351
EciI GGCGGA 1 cut(s) 283
FaeI CATG 5 cut(s) 31, 106, 155, 299, 322
FaiI YATR 7 cut(s) 29, 104, 141, 153, 297, 320, 388
FatI CATG 5 cut(s) 27, 102, 151, 295, 318
FbaI TGATCA 1 cut(s) 154
FokI GGATG 1 cut(s) 283
HgaI GACGC 1 cut(s) 74
Hin1II CATG 5 cut(s) 31, 106, 155, 299, 322
HinfI GANTC 1 cut(s) 24
HphI GGTGA 3 cut(s) 140, 149, 311
Hpy166II GTNNAC 1 cut(s) 79
Hpy188I TCNGA 2 cut(s) 23, 181
Hpy188III TCNNGA 3 cut(s) 48, 103, 364
Hpy8I GTNNAC 1 cut(s) 79
HpyAV CCTTC 1 cut(s) 100
HpyCH4IV ACGT 1 cut(s) 384
HpyCH4V TGCA 2 cut(s) 198, 218
HpyF10VI GCNNNNNNNGC 1 cut(s) 38
HpyF3I CTNAG 1 cut(s) 180
HpySE526I ACGT 1 cut(s) 384
Hsp92II CATG 5 cut(s) 31, 106, 155, 299, 322
Ksp22I TGATCA 1 cut(s) 154
Kzo9I GATC 2 cut(s) 154, 351
LpnPI CCDG 2 cut(s) 33, 316
MaeII ACGT 1 cut(s) 384
MaeIII GTNAC 1 cut(s) 299
MalI GATC 2 cut(s) 156, 353
MboI GATC 2 cut(s) 154, 351
MboII GAAGA 3 cut(s) 53, 80, 214
MluCI AATT 2 cut(s) 122, 306
MnlI CCTC 2 cut(s) 258, 380
MseI TTAA 1 cut(s) 391
MslI CAYNNNNRTG 1 cut(s) 150
MwoI GCNNNNNNNGC 1 cut(s) 38
NdeII GATC 2 cut(s) 154, 351
NlaIII CATG 5 cut(s) 31, 106, 155, 299, 322
NlaIV GGNNCC 1 cut(s) 234
NmuCI GTSAC 1 cut(s) 299
NspI RCATGY 1 cut(s) 322
PagI TCATGA 1 cut(s) 102
PfeI GAWTC 1 cut(s) 24
Ppu21I YACGTR 1 cut(s) 385
PspN4I GGNNCC 1 cut(s) 234
RseI CAYNNNNRTG 1 cut(s) 150
SaqAI TTAA 1 cut(s) 391
Sau3AI GATC 2 cut(s) 154, 351
SetI ASST 2 cut(s) 340, 387
SmiMI CAYNNNNRTG 1 cut(s) 150
SmlI CTYRAG 1 cut(s) 371
SmoI CTYRAG 1 cut(s) 371
Sse9I AATT 2 cut(s) 122, 306
SsiI CCGC 3 cut(s) 32, 230, 268
TaiI ACGT 1 cut(s) 387
TaqI TCGA 1 cut(s) 211
TasI AATT 2 cut(s) 122, 306
TfiI GAWTC 1 cut(s) 24
Tru1I TTAA 1 cut(s) 391
Tru9I TTAA 1 cut(s) 391
TseFI GTSAC 1 cut(s) 299
Tsp45I GTSAC 1 cut(s) 299
TspDTI ATGAA 3 cut(s) 16, 91, 119
XceI RCATGY 1 cut(s) 322
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.