Rh3AG309900

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3A
Physical Location & Seq
Reverse (-)
38925039 .. 38925568
530 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3AG309900.1

Sequence Viewer

Length: 198 bp
ATGAAGCCGTCGCCGTCGGTGTCAATCTCTTCCATCATGAATTTAATTTCTTCTGGTGAAACGCATCCAAGGGCTTTCAATGCATCCCCCAGCTCATCTGATGAGATTTTGCCATCGCCATTGGTGTCGAAGTGCTTGAAAATGCGCTCACGGTCGGCCTTTTCTTTGGGATCCTCTTCAGCCATTATTCACTATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

65

Amino Acids

6.88

Weight (kDa)

9.62

Isoelectric Point (pI)

95.38

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0021246)

Species Orthologous Gene IDs
prunus_persica Prupe.1G332900_v2.0.a1
pyrus_communis pycom06g13320 pycom111g01150 pycom17g01130
rosa_samantha Rh3AG309900

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 165, 178
AcsI RAATTY 1 cut(s) 40
AcuI CTGAAG 1 cut(s) 162
AgsI TTSAA 2 cut(s) 79, 139
AluBI AGCT 1 cut(s) 93
AluI AGCT 1 cut(s) 93
AlwI GGATC 2 cut(s) 165, 178
AoxI GGCC 1 cut(s) 156
ApoI RAATTY 1 cut(s) 40
AspLEI GCGC 1 cut(s) 147
AsuHPI GGTGA 1 cut(s) 68
BamHI GGATCC 1 cut(s) 170
BccI CCATC 2 cut(s) 41, 121
BmiI GGNNCC 1 cut(s) 172
BmsI GCATC 2 cut(s) 73, 92
BsaJI CCNNGG 1 cut(s) 68
BseDI CCNNGG 1 cut(s) 68
BseGI GGATG 2 cut(s) 64, 83
BseYI CCCAGC 1 cut(s) 89
Bsh1285I CGRYCG 1 cut(s) 155
BshFI GGCC 1 cut(s) 158
BsiEI CGRYCG 1 cut(s) 155
BsnI GGCC 1 cut(s) 158
Bsp143I GATC 1 cut(s) 170
BspANI GGCC 1 cut(s) 158
BspHI TCATGA 1 cut(s) 36
BspLI GGNNCC 1 cut(s) 172
BspPI GGATC 2 cut(s) 165, 178
BssECI CCNNGG 1 cut(s) 68
BssMI GATC 1 cut(s) 170
BssT1I CCWWGG 1 cut(s) 68
Bst4CI ACNGT 1 cut(s) 153
Bst6I CTCTTC 2 cut(s) 34, 181
BstF5I GGATG 2 cut(s) 64, 83
BstHHI GCGC 1 cut(s) 147
BstKTI GATC 1 cut(s) 173
BstMBI GATC 1 cut(s) 170
BstMCI CGRYCG 1 cut(s) 155
BstMWI GCNNNNNNNGC 1 cut(s) 80
BstX2I RGATCY 1 cut(s) 170
BstYI RGATCY 1 cut(s) 170
BsuRI GGCC 1 cut(s) 158
BtgZI GCGATG 1 cut(s) 99
BtsCI GGATG 2 cut(s) 64, 83
CciI TCATGA 1 cut(s) 36
CfoI GCGC 1 cut(s) 147
CviAII CATG 1 cut(s) 37
CviJI RGCY 5 cut(s) 7, 74, 93, 158, 182
CviKI_1 RGCY 5 cut(s) 7, 74, 93, 158, 182
DpnI GATC 1 cut(s) 172
DpnII GATC 1 cut(s) 170
Eam1104I CTCTTC 2 cut(s) 34, 181
EarI CTCTTC 2 cut(s) 34, 181
Eco130I CCWWGG 1 cut(s) 68
Eco57I CTGAAG 1 cut(s) 162
EcoT14I CCWWGG 1 cut(s) 68
EcoT22I ATGCAT 1 cut(s) 85
ErhI CCWWGG 1 cut(s) 68
FaeI CATG 1 cut(s) 40
FaiI YATR 1 cut(s) 38
FatI CATG 1 cut(s) 36
FokI GGATG 2 cut(s) 51, 70
GlaI GCGC 1 cut(s) 146
GsaI CCCAGC 1 cut(s) 93
HaeIII GGCC 1 cut(s) 158
HhaI GCGC 1 cut(s) 147
Hin1II CATG 1 cut(s) 40
Hin6I GCGC 1 cut(s) 145
HinP1I GCGC 1 cut(s) 145
HphI GGTGA 1 cut(s) 68
Hpy188I TCNGA 1 cut(s) 100
Hpy188III TCNNGA 1 cut(s) 37
Hpy99I CGWCG 2 cut(s) 13, 19
HpyCH4III ACNGT 1 cut(s) 153
HpyCH4V TGCA 1 cut(s) 83
HpyF10VI GCNNNNNNNGC 1 cut(s) 80
Hsp92II CATG 1 cut(s) 40
HspAI GCGC 1 cut(s) 145
Kzo9I GATC 1 cut(s) 170
LpnPI CCDG 2 cut(s) 39, 103
LweI GCATC 2 cut(s) 73, 92
MalI GATC 1 cut(s) 172
MboI GATC 1 cut(s) 170
MboII GAAGA 3 cut(s) 21, 42, 168
MflI RGATCY 1 cut(s) 170
MluCI AATT 2 cut(s) 40, 45
MnlI CCTC 1 cut(s) 184
Mph1103I ATGCAT 1 cut(s) 85
MseI TTAA 1 cut(s) 44
MwoI GCNNNNNNNGC 1 cut(s) 80
NdeII GATC 1 cut(s) 170
NlaIII CATG 1 cut(s) 40
NlaIV GGNNCC 1 cut(s) 172
NsiI ATGCAT 1 cut(s) 85
PagI TCATGA 1 cut(s) 36
PspFI CCCAGC 1 cut(s) 89
PspN4I GGNNCC 1 cut(s) 172
PsuI RGATCY 1 cut(s) 170
SaqAI TTAA 1 cut(s) 44
Sau3AI GATC 1 cut(s) 170
SetI ASST 1 cut(s) 95
SfaNI GCATC 2 cut(s) 73, 92
SgeI CNNG 6 cut(s) 49, 66, 81, 102, 148, 162
Sse9I AATT 2 cut(s) 40, 45
StyI CCWWGG 1 cut(s) 68
TaaI ACNGT 1 cut(s) 153
TaqI TCGA 1 cut(s) 128
TasI AATT 2 cut(s) 40, 45
Tru1I TTAA 1 cut(s) 44
Tru9I TTAA 1 cut(s) 44
TspDTI ATGAA 2 cut(s) 17, 53
XapI RAATTY 1 cut(s) 40
Zsp2I ATGCAT 1 cut(s) 85
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.