Rh3BG303400

isoform X1

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3B
Physical Location & Seq
Forward (+)
30651376 .. 30651780
405 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3BG303400.1

Sequence Viewer

Length: 306 bp
ATGGGTGGCATGGGAAAATTAGAGGCGGTGCGACGCTCTATCTGCATTGATTCCGAGTGGAGGAGGAGGGAGCTAATTGATTACATTCAGAGGGTAATCAAAGGCTGTTTCGGAACTGAGGTCTTGTCCTTTGGCTCAGTCCCTTTAAAAACCTATCTTCCTGATGGAGATATTGATTTGACAGTACTCTGTCATCGGAACAAGGCGGAAGACTTAGCTAGAGCTGTCTGCAGTCTCCTAGAAGGTGAACCAAAGGAACCTGGGTTCCTGGTTAAAGATGTTAGATACGTTTATGCAAAGGTTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

101

Amino Acids

11.41

Weight (kDa)

7.64

Isoelectric Point (pI)

46.24

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0021176)

Species Orthologous Gene IDs
malus_domestica MD01G1165100.v1.1
pyrus_communis pycom07g21020
rosa_chinensis RchiOBHm_Chr3g0485471
rosa_samantha Rh3AG267900 Rh3BG303400

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 26, 206
AfaI GTAC 1 cut(s) 186
AfiI CCNNNNNNNGG 1 cut(s) 60
AjnI CCWGG 2 cut(s) 259, 267
AloI GAACNNNNNNTCC 4 cut(s) 248, 249, 280, 281
AluBI AGCT 3 cut(s) 73, 218, 224
AluI AGCT 3 cut(s) 73, 218, 224
Alw26I GTCTC 1 cut(s) 239
AsuHPI GGTGA 1 cut(s) 257
BbsI GAAGAC 1 cut(s) 216
BccI CCATC 1 cut(s) 158
BciT130I CCWGG 2 cut(s) 261, 269
BcoDI GTCTC 1 cut(s) 239
BfaI CTAG 2 cut(s) 219, 239
BfmI CTRYAG 1 cut(s) 229
BmcAI AGTACT 1 cut(s) 186
Bme1390I CCNGG 2 cut(s) 261, 269
BmiI GGNNCC 2 cut(s) 258, 266
BmrFI CCNGG 2 cut(s) 261, 269
BpiI GAAGAC 1 cut(s) 216
BsaJI CCNNGG 1 cut(s) 260
Bsc4I CCNNNNNNNGG 1 cut(s) 60
BseBI CCWGG 2 cut(s) 261, 269
BseDI CCNNGG 1 cut(s) 260
BseLI CCNNNNNNNGG 1 cut(s) 60
BseMII CTCAG 2 cut(s) 108, 150
BseRI GAGGAG 2 cut(s) 76, 79
BslFI GGGAC 1 cut(s) 125
BslI CCNNNNNNNGG 1 cut(s) 60
BsmAI GTCTC 1 cut(s) 239
BsmFI GGGAC 1 cut(s) 125
BspACI CCGC 2 cut(s) 26, 206
BspCNI CTCAG 2 cut(s) 109, 149
BspLI GGNNCC 2 cut(s) 258, 266
BspMAI CTGCAG 1 cut(s) 233
BssECI CCNNGG 1 cut(s) 260
Bst2UI CCWGG 2 cut(s) 261, 269
Bst4CI ACNGT 1 cut(s) 184
BstDEI CTNAG 3 cut(s) 117, 136, 214
BstMAI GTCTC 1 cut(s) 239
BstMWI GCNNNNNNNGC 1 cut(s) 42
BstNI CCWGG 2 cut(s) 261, 269
BstSCI CCNGG 2 cut(s) 259, 267
BstSFI CTRYAG 1 cut(s) 229
BstV2I GAAGAC 1 cut(s) 216
CseI GACGC 1 cut(s) 42
Csp6I GTAC 1 cut(s) 185
CviAII CATG 1 cut(s) 10
CviJI RGCY 5 cut(s) 73, 105, 135, 218, 224
CviKI_1 RGCY 5 cut(s) 73, 105, 135, 218, 224
CviQI GTAC 1 cut(s) 185
DdeI CTNAG 3 cut(s) 117, 136, 214
DraI TTTAAA 1 cut(s) 147
EciI GGCGGA 1 cut(s) 221
EcoRII CCWGG 2 cut(s) 259, 267
FaeI CATG 1 cut(s) 13
FaiI YATR 2 cut(s) 11, 294
FaqI GGGAC 1 cut(s) 125
FatI CATG 1 cut(s) 9
FspBI CTAG 2 cut(s) 219, 239
HgaI GACGC 1 cut(s) 42
Hin1II CATG 1 cut(s) 13
HinfI GANTC 1 cut(s) 50
HphI GGTGA 1 cut(s) 257
Hpy166II GTNNAC 1 cut(s) 248
Hpy188I TCNGA 4 cut(s) 55, 90, 113, 198
Hpy188III TCNNGA 1 cut(s) 161
Hpy8I GTNNAC 1 cut(s) 248
Hpy99I CGWCG 1 cut(s) 36
HpyAV CCTTC 1 cut(s) 236
HpyCH4III ACNGT 1 cut(s) 184
HpyCH4IV ACGT 1 cut(s) 288
HpyCH4V TGCA 3 cut(s) 45, 231, 296
HpyF10VI GCNNNNNNNGC 1 cut(s) 42
HpyF3I CTNAG 3 cut(s) 117, 136, 214
HpySE526I ACGT 1 cut(s) 288
Hsp92II CATG 1 cut(s) 13
LmnI GCTCC 1 cut(s) 70
LpnPI CCDG 5 cut(s) 174, 246, 254, 273, 281
MaeI CTAG 2 cut(s) 219, 239
MaeII ACGT 1 cut(s) 288
MboII GAAGA 2 cut(s) 149, 221
MluCI AATT 2 cut(s) 17, 75
MnlI CCTC 6 cut(s) 16, 54, 57, 60, 84, 112
MseI TTAA 2 cut(s) 146, 273
MspR9I CCNGG 2 cut(s) 261, 269
MvaI CCWGG 2 cut(s) 261, 269
MwoI GCNNNNNNNGC 1 cut(s) 42
NlaIII CATG 1 cut(s) 13
NlaIV GGNNCC 2 cut(s) 258, 266
PfeI GAWTC 1 cut(s) 50
Psp6I CCWGG 2 cut(s) 259, 267
PspGI CCWGG 2 cut(s) 259, 267
PspN4I GGNNCC 2 cut(s) 258, 266
PstI CTGCAG 1 cut(s) 233
RsaI GTAC 1 cut(s) 186
RsaNI GTAC 1 cut(s) 185
SaqAI TTAA 2 cut(s) 146, 273
ScaI AGTACT 1 cut(s) 186
ScrFI CCNGG 2 cut(s) 261, 269
SetI ASST 9 cut(s) 75, 123, 155, 220, 226, 247, 262, 291, 303
SfcI CTRYAG 1 cut(s) 229
Sse9I AATT 2 cut(s) 17, 75
SsiI CCGC 2 cut(s) 26, 206
SspMI CTAG 2 cut(s) 219, 239
StyD4I CCNGG 2 cut(s) 259, 267
TaaI ACNGT 1 cut(s) 184
TaiI ACGT 1 cut(s) 291
TasI AATT 2 cut(s) 17, 75
TatI WGTACW 1 cut(s) 184
TfiI GAWTC 1 cut(s) 50
Tru1I TTAA 2 cut(s) 146, 273
Tru9I TTAA 2 cut(s) 146, 273
XspI CTAG 2 cut(s) 219, 239
ZrmI AGTACT 1 cut(s) 186
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.