Rh3DG119600

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3D
Physical Location & Seq
Reverse (-)
10057173 .. 10064085
6913 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3DG119600.1

Sequence Viewer

Length: 267 bp
ATGGCAGCTATTGCTCCGTTCTCGCCTTCCTTGGCTCCCAACAAGTCTGAAGACGATGAAGTTATCATCCTCGGTGACCCGAAATTCGCTCTCAACGGTGAGCTTTTGTTGCTTTTTCTGGTCCTGCTGTTCGCCACCTTGTTCATCGTTCTCATAGTCTTTCTCTACGGAAGGAATCATCGTAATCAGATTCATCTGAGAATTCAACTCAGCCGTCAAGCCAGGGAGAACAATCCTGATATGGTGCTTCAGAATCTAACACTATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

88

Amino Acids

9.96

Weight (kDa)

6.03

Isoelectric Point (pI)

41.27

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0022469)

Species Orthologous Gene IDs
prunus_persica Prupe.6G282100_v2.0.a1
rosa_chinensis RchiOBHm_Chr3g0462331
rosa_samantha Rh3CG120500 Rh3DG119600

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 83, 201
AcuI CTGAAG 2 cut(s) 69, 233
AgsI TTSAA 1 cut(s) 206
AjnI CCWGG 1 cut(s) 221
AluBI AGCT 2 cut(s) 8, 103
AluI AGCT 2 cut(s) 8, 103
ApeKI GCWGC 1 cut(s) 5
ApoI RAATTY 2 cut(s) 83, 201
ArsI GACNNNNNNTTYG 2 cut(s) 68, 100
AspS9I GGNCC 1 cut(s) 121
AsuHPI GGTGA 2 cut(s) 86, 110
AvaII GGWCC 1 cut(s) 121
BbsI GAAGAC 1 cut(s) 57
BbvI GCAGC 1 cut(s) 17
BceAI ACGGC 1 cut(s) 198
BciT130I CCWGG 1 cut(s) 223
BisI GCNGC 1 cut(s) 6
BlsI GCNGC 1 cut(s) 7
Bme1390I CCNGG 1 cut(s) 223
Bme18I GGWCC 1 cut(s) 121
BmgT120I GGNCC 1 cut(s) 121
BmiI GGNNCC 1 cut(s) 36
BmrFI CCNGG 1 cut(s) 223
BpiI GAAGAC 1 cut(s) 57
BsaJI CCNNGG 3 cut(s) 30, 70, 222
BseBI CCWGG 1 cut(s) 223
BseDI CCNNGG 3 cut(s) 30, 70, 222
BseGI GGATG 1 cut(s) 66
BseMII CTCAG 2 cut(s) 188, 223
BseXI GCAGC 1 cut(s) 17
BspCNI CTCAG 2 cut(s) 189, 222
BspLI GGNNCC 1 cut(s) 36
BssECI CCNNGG 3 cut(s) 30, 70, 222
BssT1I CCWWGG 1 cut(s) 30
Bst2UI CCWGG 1 cut(s) 223
Bst4CI ACNGT 1 cut(s) 98
BstAPI GCANNNNNTGC 1 cut(s) 11
BstDEI CTNAG 2 cut(s) 197, 209
BstEII GGTNACC 1 cut(s) 74
BstF5I GGATG 1 cut(s) 66
BstMWI GCNNNNNNNGC 2 cut(s) 11, 109
BstNI CCWGG 1 cut(s) 223
BstPI GGTNACC 1 cut(s) 74
BstSCI CCNGG 1 cut(s) 221
BstV1I GCAGC 1 cut(s) 17
BstV2I GAAGAC 1 cut(s) 57
BtsCI GGATG 1 cut(s) 66
Cfr13I GGNCC 1 cut(s) 121
CviJI RGCY 5 cut(s) 8, 35, 103, 213, 221
CviKI_1 RGCY 5 cut(s) 8, 35, 103, 213, 221
DdeI CTNAG 2 cut(s) 197, 209
Eco130I CCWWGG 1 cut(s) 30
Eco47I GGWCC 1 cut(s) 121
Eco57I CTGAAG 2 cut(s) 69, 233
Eco91I GGTNACC 1 cut(s) 74
EcoO65I GGTNACC 1 cut(s) 74
EcoRI GAATTC 1 cut(s) 201
EcoRII CCWGG 1 cut(s) 221
EcoT14I CCWWGG 1 cut(s) 30
ErhI CCWWGG 1 cut(s) 30
FaiI YATR 3 cut(s) 155, 242, 265
Fnu4HI GCNGC 1 cut(s) 6
FokI GGATG 1 cut(s) 53
Fsp4HI GCNGC 1 cut(s) 6
GluI GCNGC 1 cut(s) 6
HinfI GANTC 3 cut(s) 175, 190, 253
HphI GGTGA 2 cut(s) 86, 110
Hpy188I TCNGA 4 cut(s) 49, 189, 198, 252
Hpy188III TCNNGA 1 cut(s) 236
HpyAV CCTTC 2 cut(s) 36, 165
HpyCH4III ACNGT 1 cut(s) 98
HpyF10VI GCNNNNNNNGC 2 cut(s) 11, 109
HpyF3I CTNAG 2 cut(s) 197, 209
LmnI GCTCC 2 cut(s) 19, 40
LpnPI CCDG 5 cut(s) 104, 137, 208, 235, 249
Lsp1109I GCAGC 1 cut(s) 17
MaeIII GTNAC 1 cut(s) 74
MboII GAAGA 1 cut(s) 62
MluCI AATT 2 cut(s) 83, 201
MnlI CCTC 1 cut(s) 80
MspR9I CCNGG 1 cut(s) 223
MvaI CCWGG 1 cut(s) 223
MwoI GCNNNNNNNGC 2 cut(s) 11, 109
NlaIV GGNNCC 1 cut(s) 36
NmuCI GTSAC 1 cut(s) 74
PfeI GAWTC 3 cut(s) 175, 190, 253
PkrI GCNGC 1 cut(s) 7
Psp6I CCWGG 1 cut(s) 221
PspEI GGTNACC 1 cut(s) 74
PspGI CCWGG 1 cut(s) 221
PspN4I GGNNCC 1 cut(s) 36
PspPI GGNCC 1 cut(s) 121
SatI GCNGC 1 cut(s) 6
Sau96I GGNCC 1 cut(s) 121
ScrFI CCNGG 1 cut(s) 223
SetI ASST 3 cut(s) 10, 105, 140
SinI GGWCC 1 cut(s) 121
Sse9I AATT 2 cut(s) 83, 201
StyD4I CCNGG 1 cut(s) 221
StyI CCWWGG 1 cut(s) 30
TaaI ACNGT 1 cut(s) 98
TasI AATT 2 cut(s) 83, 201
TfiI GAWTC 3 cut(s) 175, 190, 253
TseFI GTSAC 1 cut(s) 74
TseI GCWGC 1 cut(s) 5
Tsp45I GTSAC 1 cut(s) 74
TspDTI ATGAA 3 cut(s) 72, 133, 182
TspGWI ACGGA 2 cut(s) 6, 183
VpaK11BI GGWCC 1 cut(s) 121
XapI RAATTY 2 cut(s) 83, 201
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.