Rh4AG126300

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4A
Physical Location & Seq
Reverse (-)
27338637 .. 27370352
31716 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4AG126300.1

Sequence Viewer

Length: 186 bp
ATGCAACACAACAATGAAATAACTAATCAACAGACTGCAATAAATGAACCAAATTCAGAAATATTAGTTAGTACTGTTGAAAAAATTCTTCTAGGTAGTCAGGCTGTTGTGGTTAGGGGTTTTAGTGTGGTGGCCCTGGCCAGCTCTAGCAAGCTTAACCCTATCTTAAGCTCCCTTCATGCTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

61

Amino Acids

6.5

Weight (kDa)

6.0

Isoelectric Point (pI)

42.02

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018920)

Species Orthologous Gene IDs
prunus_persica Prupe.1G097700_v2.0.a1
pyrus_communis pycom16g23040
rosa_chinensis RchiOBHm_Chr4g0404971
rosa_roxburghii Rroxscaffold_5G00349100
rosa_rugosa Rorug04G0050600
rosa_samantha Rh4AG126300 Rh4BG120500 Rh4CG134500 Rh4DG120800

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 138
AcsI RAATTY 2 cut(s) 52, 84
AfaI GTAC 1 cut(s) 73
AflII CTTAAG 1 cut(s) 166
AgsI TTSAA 1 cut(s) 80
AjnI CCWGG 1 cut(s) 135
AluBI AGCT 3 cut(s) 144, 154, 171
AluI AGCT 3 cut(s) 144, 154, 171
AoxI GGCC 2 cut(s) 132, 138
ApoI RAATTY 2 cut(s) 52, 84
Asp700I GAANNNNTTC 1 cut(s) 84
AspS9I GGNCC 1 cut(s) 133
BalI TGGCCA 1 cut(s) 140
BciT130I CCWGG 1 cut(s) 137
BfaI CTAG 2 cut(s) 92, 147
BfrI CTTAAG 1 cut(s) 166
BmcAI AGTACT 1 cut(s) 73
Bme1390I CCNGG 1 cut(s) 137
BmgT120I GGNCC 1 cut(s) 133
BmrFI CCNGG 1 cut(s) 137
BsaJI CCNNGG 1 cut(s) 135
BseBI CCWGG 1 cut(s) 137
BseDI CCNNGG 1 cut(s) 135
BshFI GGCC 2 cut(s) 134, 140
BsnI GGCC 2 cut(s) 134, 140
BspANI GGCC 2 cut(s) 134, 140
BspTI CTTAAG 1 cut(s) 166
BssECI CCNNGG 1 cut(s) 135
Bst2UI CCWGG 1 cut(s) 137
Bst4CI ACNGT 1 cut(s) 76
BstAFI CTTAAG 1 cut(s) 166
BstC8I GCNNGC 2 cut(s) 142, 152
BstDEI CTNAG 1 cut(s) 183
BstNI CCWGG 1 cut(s) 137
BstSCI CCNGG 1 cut(s) 135
BsuRI GGCC 2 cut(s) 134, 140
Cac8I GCNNGC 2 cut(s) 142, 152
Cfr13I GGNCC 1 cut(s) 133
Csp6I GTAC 1 cut(s) 72
CviAII CATG 1 cut(s) 179
CviJI RGCY 6 cut(s) 104, 134, 140, 144, 154, 171
CviKI_1 RGCY 6 cut(s) 104, 134, 140, 144, 154, 171
CviQI GTAC 1 cut(s) 72
DdeI CTNAG 1 cut(s) 183
EaeI YGGCCR 1 cut(s) 138
EcoRII CCWGG 1 cut(s) 135
FaeI CATG 1 cut(s) 182
FaiI YATR 1 cut(s) 180
FatI CATG 1 cut(s) 178
FspBI CTAG 2 cut(s) 92, 147
HaeIII GGCC 2 cut(s) 134, 140
Hin1II CATG 1 cut(s) 182
HindIII AAGCTT 1 cut(s) 152
Hpy188I TCNGA 1 cut(s) 58
HpyAV CCTTC 1 cut(s) 185
HpyCH4III ACNGT 1 cut(s) 76
HpyCH4V TGCA 2 cut(s) 4, 38
HpyF3I CTNAG 1 cut(s) 183
Hsp92II CATG 1 cut(s) 182
LmnI GCTCC 1 cut(s) 176
LpnPI CCDG 4 cut(s) 86, 122, 149, 154
MaeI CTAG 2 cut(s) 92, 147
MboII GAAGA 1 cut(s) 80
MlsI TGGCCA 1 cut(s) 140
MluCI AATT 2 cut(s) 52, 84
MluNI TGGCCA 1 cut(s) 140
Mox20I TGGCCA 1 cut(s) 140
MroXI GAANNNNTTC 1 cut(s) 84
MscI TGGCCA 1 cut(s) 140
MseI TTAA 2 cut(s) 156, 167
MslI CAYNNNNRTG 1 cut(s) 12
Msp20I TGGCCA 1 cut(s) 140
MspCI CTTAAG 1 cut(s) 166
MspR9I CCNGG 1 cut(s) 137
MvaI CCWGG 1 cut(s) 137
NlaIII CATG 1 cut(s) 182
PdmI GAANNNNTTC 1 cut(s) 84
Psp6I CCWGG 1 cut(s) 135
PspGI CCWGG 1 cut(s) 135
PspPI GGNCC 1 cut(s) 133
RsaI GTAC 1 cut(s) 73
RsaNI GTAC 1 cut(s) 72
RseI CAYNNNNRTG 1 cut(s) 12
SaqAI TTAA 2 cut(s) 156, 167
Sau96I GGNCC 1 cut(s) 133
ScaI AGTACT 1 cut(s) 73
ScrFI CCNGG 1 cut(s) 137
SetI ASST 4 cut(s) 97, 146, 156, 173
SgeI CNNG 7 cut(s) 104, 113, 148, 149, 153, 159, 163
SmiMI CAYNNNNRTG 1 cut(s) 12
SmlI CTYRAG 1 cut(s) 166
SmoI CTYRAG 1 cut(s) 166
Sse9I AATT 2 cut(s) 52, 84
SspI AATATT 1 cut(s) 63
SspMI CTAG 2 cut(s) 92, 147
StyD4I CCNGG 1 cut(s) 135
TaaI ACNGT 1 cut(s) 76
TasI AATT 2 cut(s) 52, 84
TatI WGTACW 1 cut(s) 71
Tru1I TTAA 2 cut(s) 156, 167
Tru9I TTAA 2 cut(s) 156, 167
TspDTI ATGAA 3 cut(s) 30, 60, 167
Vha464I CTTAAG 1 cut(s) 166
XapI RAATTY 2 cut(s) 52, 84
XmnI GAANNNNTTC 1 cut(s) 84
XspI CTAG 2 cut(s) 92, 147
ZrmI AGTACT 1 cut(s) 73
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.