Basic Information

Type: gene

Biological Identity

Species

rosa_samantha

Chromosome

Chr4B

Orthogroup ID

OG0018920

Physical Location & Seq

Genomic Coordinates Reverse (-)

20115468 .. 20124945

Gene Structure 9478 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rh4BG120500.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 300 bp

ATGAGAACAAGGAGTTCAATTCCATGGAGAATTAAGTCGAAGAAGAGAAAGCTAAAGCTCTCTTTTGGTAGAAACTCCGAACTGGTTGCCAAATCGTCCATAAAAAGGAGTCTGATGGAGCTGGGAAGGATCATCCCCGGGTGCATTGTTGACAGCAATAACCCAGAAACCTTGTTCCAAGGAATTGCTAATTACATCTATCTCCTGGAAACCAAAGCTGTTGTGGTTAGGGGTTTTAGTGTGGTGGCCCTGGCCAGCTCTAGCAAGCTTAACCCTATCTTAAGCTCCCTTCATGCTTAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

99

Amino Acids

10.99

Weight (kDa)

10.81

Isoelectric Point (pI)

32.47

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0018920)

Species	Orthologous Gene IDs
prunus_persica	Prupe.1G097700_v2.0.a1
pyrus_communis	pycom16g23040
rosa_chinensis	RchiOBHm_Chr4g0404971
rosa_roxburghii	Rroxscaffold_5G00349100
rosa_rugosa	Rorug04G0050600
rosa_samantha	Rh4AG126300 Rh4BG120500 Rh4CG134500 Rh4DG120800

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AclWI	GGATC	1 cut(s)	137
AcoI	YGGCCR	1 cut(s)	252
AfiI	CCNNNNNNNGG	1 cut(s)	105
AflII	CTTAAG	1 cut(s)	280
AgsI	TTSAA	1 cut(s)	18
AjnI	CCWGG	2 cut(s)	204, 249
AluBI	AGCT	7 cut(s)	52, 58, 121, 218, 258, 268, 285
AluI	AGCT	7 cut(s)	52, 58, 121, 218, 258, 268, 285
AlwI	GGATC	1 cut(s)	137
Ama87I	CYCGRG	1 cut(s)	137
AoxI	GGCC	2 cut(s)	246, 252
AspS9I	GGNCC	1 cut(s)	247
AsuC2I	CCSGG	2 cut(s)	138, 139
AvaI	CYCGRG	1 cut(s)	137
BalI	TGGCCA	1 cut(s)	254
BccI	CCATC	1 cut(s)	109
BcgI	CGANNNNNNTGC	2 cut(s)	68, 102
BciT130I	CCWGG	2 cut(s)	206, 251
BcnI	CCSGG	2 cut(s)	138, 139
BfaI	CTAG	1 cut(s)	261
BfrI	CTTAAG	1 cut(s)	280
Bme1390I	CCNGG	4 cut(s)	138, 139, 206, 251
BmeT110I	CYCGRG	1 cut(s)	137
BmgT120I	GGNCC	1 cut(s)	247
BmrFI	CCNGG	4 cut(s)	138, 139, 206, 251
BpuMI	CCSGG	2 cut(s)	138, 139
BsaJI	CCNNGG	5 cut(s)	23, 136, 137, 178, 249
Bsc4I	CCNNNNNNNGG	1 cut(s)	105
Bse1I	ACTGG	1 cut(s)	87
BseBI	CCWGG	2 cut(s)	206, 251
BseDI	CCNNGG	5 cut(s)	23, 136, 137, 178, 249
BseGI	GGATG	1 cut(s)	132
BseLI	CCNNNNNNNGG	1 cut(s)	105
BseNI	ACTGG	1 cut(s)	87
BseYI	CCCAGC	1 cut(s)	121
BshFI	GGCC	2 cut(s)	248, 254
BsiHKCI	CYCGRG	1 cut(s)	137
BsiSI	CCGG	1 cut(s)	138
BslI	CCNNNNNNNGG	1 cut(s)	105
BsnI	GGCC	2 cut(s)	248, 254
BsoBI	CYCGRG	1 cut(s)	137
Bsp143I	GATC	1 cut(s)	129
Bsp19I	CCATGG	1 cut(s)	23
BspANI	GGCC	2 cut(s)	248, 254
BspPI	GGATC	1 cut(s)	137
BspTI	CTTAAG	1 cut(s)	280
BsrI	ACTGG	1 cut(s)	87
BssECI	CCNNGG	5 cut(s)	23, 136, 137, 178, 249
BssMI	GATC	1 cut(s)	129
BssT1I	CCWWGG	2 cut(s)	23, 178
Bst2UI	CCWGG	2 cut(s)	206, 251
Bst6I	CTCTTC	1 cut(s)	38
BstAFI	CTTAAG	1 cut(s)	280
BstC8I	GCNNGC	2 cut(s)	256, 266
BstDEI	CTNAG	1 cut(s)	297
BstDSI	CCRYGG	1 cut(s)	23
BstF5I	GGATG	1 cut(s)	132
BstKTI	GATC	1 cut(s)	132
BstMBI	GATC	1 cut(s)	129
BstNI	CCWGG	2 cut(s)	206, 251
BstSCI	CCNGG	4 cut(s)	136, 137, 204, 249
BsuRI	GGCC	2 cut(s)	248, 254
BtgI	CCRYGG	1 cut(s)	23
BtsCI	GGATG	1 cut(s)	132
Cac8I	GCNNGC	2 cut(s)	256, 266
Cfr13I	GGNCC	1 cut(s)	247
Cfr9I	CCCGGG	1 cut(s)	137
CviAII	CATG	2 cut(s)	24, 293
CviJI	RGCY	9 cut(s)	52, 58, 121, 218, 248, 254, 258, 268, 285
CviKI_1	RGCY	9 cut(s)	52, 58, 121, 218, 248, 254, 258, 268, 285
DdeI	CTNAG	1 cut(s)	297
DpnI	GATC	1 cut(s)	131
DpnII	GATC	1 cut(s)	129
EaeI	YGGCCR	1 cut(s)	252
Eam1104I	CTCTTC	1 cut(s)	38
EarI	CTCTTC	1 cut(s)	38
Eco130I	CCWWGG	2 cut(s)	23, 178
Eco88I	CYCGRG	1 cut(s)	137
EcoRII	CCWGG	2 cut(s)	204, 249
EcoT14I	CCWWGG	2 cut(s)	23, 178
ErhI	CCWWGG	2 cut(s)	23, 178
FaeI	CATG	2 cut(s)	27, 296
FaiI	YATR	3 cut(s)	25, 101, 294
FatI	CATG	2 cut(s)	23, 292
FokI	GGATG	1 cut(s)	119
FspBI	CTAG	1 cut(s)	261
GsaI	CCCAGC	1 cut(s)	125
HaeIII	GGCC	2 cut(s)	248, 254
HapII	CCGG	1 cut(s)	138
Hin1II	CATG	2 cut(s)	27, 296
HincII	GTYRAC	1 cut(s)	151
HindII	GTYRAC	1 cut(s)	151
HindIII	AAGCTT	1 cut(s)	266
HinfI	GANTC	1 cut(s)	109
HpaII	CCGG	1 cut(s)	138
Hpy166II	GTNNAC	1 cut(s)	151
Hpy188I	TCNGA	2 cut(s)	79, 114
Hpy8I	GTNNAC	1 cut(s)	151
HpyAV	CCTTC	2 cut(s)	120, 299
HpyCH4V	TGCA	1 cut(s)	144
HpyF3I	CTNAG	1 cut(s)	297
Hsp92II	CATG	2 cut(s)	27, 296
Kzo9I	GATC	1 cut(s)	129
LmnI	GCTCC	2 cut(s)	118, 290
LpnPI	CCDG	9 cut(s)	68, 107, 151, 177, 191, 218, 236, 263, 268
MaeI	CTAG	1 cut(s)	261
MalI	GATC	1 cut(s)	131
MboI	GATC	1 cut(s)	129
MboII	GAAGA	2 cut(s)	52, 55
MlsI	TGGCCA	1 cut(s)	254
MluCI	AATT	4 cut(s)	18, 30, 183, 190
MluNI	TGGCCA	1 cut(s)	254
MlyI	GAGTC	1 cut(s)	118
Mox20I	TGGCCA	1 cut(s)	254
MscI	TGGCCA	1 cut(s)	254
MseI	TTAA	3 cut(s)	33, 270, 281
Msp20I	TGGCCA	1 cut(s)	254
MspCI	CTTAAG	1 cut(s)	280
MspI	CCGG	1 cut(s)	138
MspR9I	CCNGG	4 cut(s)	138, 139, 206, 251
MvaI	CCWGG	2 cut(s)	206, 251
NciI	CCSGG	2 cut(s)	138, 139
NcoI	CCATGG	1 cut(s)	23
NdeII	GATC	1 cut(s)	129
NlaIII	CATG	2 cut(s)	27, 296
PfoI	TCCNGGA	1 cut(s)	204
PleI	GAGTC	1 cut(s)	117
PpsI	GAGTC	1 cut(s)	117
Psp6I	CCWGG	2 cut(s)	204, 249
PspFI	CCCAGC	1 cut(s)	121
PspGI	CCWGG	2 cut(s)	204, 249
PspPI	GGNCC	1 cut(s)	247
SaqAI	TTAA	3 cut(s)	33, 270, 281
Sau3AI	GATC	1 cut(s)	129
Sau96I	GGNCC	1 cut(s)	247
SchI	GAGTC	1 cut(s)	118
ScrFI	CCNGG	4 cut(s)	138, 139, 206, 251
SetI	ASST	8 cut(s)	54, 60, 123, 173, 220, 260, 270, 287
SmaI	CCCGGG	1 cut(s)	139
SmlI	CTYRAG	1 cut(s)	280
SmoI	CTYRAG	1 cut(s)	280
Sse9I	AATT	4 cut(s)	18, 30, 183, 190
SspMI	CTAG	1 cut(s)	261
StyD4I	CCNGG	4 cut(s)	136, 137, 204, 249
StyI	CCWWGG	2 cut(s)	23, 178
TaqI	TCGA	1 cut(s)	38
TasI	AATT	4 cut(s)	18, 30, 183, 190
Tru1I	TTAA	3 cut(s)	33, 270, 281
Tru9I	TTAA	3 cut(s)	33, 270, 281
TspDTI	ATGAA	1 cut(s)	281
TspMI	CCCGGG	1 cut(s)	137
Vha464I	CTTAAG	1 cut(s)	280
XcmI	CCANNNNNNNNNTGG	1 cut(s)	220
XmaI	CCCGGG	1 cut(s)	137
XspI	CTAG	1 cut(s)	261

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.