Rh4BG044200

splicing factor 3B subunit 2

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4B
Physical Location & Seq
Reverse (-)
7949009 .. 7960826
11818 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4BG044200.1

Sequence Viewer

Length: 258 bp
ATGCATTCAAGGTTTAATACATTTGCTGGTGAACATGATGATGTTGCAATTCTGAACAGGCGGAACAAGATAAAGAACCAAAAGAGAGGCGTTCCAAACAAGAAAAAGGTCAAATTAAGAGAGAAGAAGCCAGGCATGCTGTCACATGAACTGAAAGAAGGTCTTGGTGTGCCAGATGGTGCTCCTCCGCCATGGCTCATTAACATACAGAGATATGGTCCTCCTCCATCACGTCCACAGTTGAAATCTCTGGACTGA

Protein Analysis

85

Amino Acids

9.67

Weight (kDa)

10.44

Isoelectric Point (pI)

58.03

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PSP PF04046 43 - 82 4.6e-14 PSP
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0022746)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr4g0393571
rosa_laevigata RLG00000009740
rosa_samantha Rh4BG044200 Rh4CG051000

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 61, 188
AgsI TTSAA 2 cut(s) 9, 244
AjiI CACGTC 1 cut(s) 233
AjnI CCWGG 1 cut(s) 130
Alw21I GWGCWC 1 cut(s) 184
AspS9I GGNCC 1 cut(s) 218
AsuHPI GGTGA 1 cut(s) 41
AvaII GGWCC 1 cut(s) 218
Bbv12I GWGCWC 1 cut(s) 184
BccI CCATC 2 cut(s) 170, 235
BciT130I CCWGG 1 cut(s) 132
Bme1390I CCNGG 1 cut(s) 132
Bme18I GGWCC 1 cut(s) 218
BmgBI CACGTC 1 cut(s) 233
BmgT120I GGNCC 1 cut(s) 218
BmrFI CCNGG 1 cut(s) 132
BsaJI CCNNGG 1 cut(s) 191
BseBI CCWGG 1 cut(s) 132
BseDI CCNNGG 1 cut(s) 191
BseRI GAGGAG 2 cut(s) 174, 213
BsiHKAI GWGCWC 1 cut(s) 184
BsmI GAATGC 1 cut(s) 4
Bsp1286I GDGCHC 1 cut(s) 184
Bsp19I CCATGG 1 cut(s) 191
BspACI CCGC 2 cut(s) 61, 188
BssECI CCNNGG 1 cut(s) 191
BssT1I CCWWGG 1 cut(s) 191
Bst2UI CCWGG 1 cut(s) 132
Bst4CI ACNGT 1 cut(s) 240
BstC8I GCNNGC 1 cut(s) 137
BstDSI CCRYGG 1 cut(s) 191
BstMWI GCNNNNNNNGC 1 cut(s) 136
BstNI CCWGG 1 cut(s) 132
BstNSI RCATGY 1 cut(s) 139
BstSCI CCNGG 1 cut(s) 130
BtgI CCRYGG 1 cut(s) 191
BtrI CACGTC 1 cut(s) 233
Cac8I GCNNGC 1 cut(s) 137
Cfr13I GGNCC 1 cut(s) 218
CviAII CATG 4 cut(s) 35, 136, 146, 192
CviJI RGCY 2 cut(s) 130, 196
CviKI_1 RGCY 2 cut(s) 130, 196
EciI GGCGGA 2 cut(s) 76, 177
Eco130I CCWWGG 1 cut(s) 191
Eco47I GGWCC 1 cut(s) 218
EcoRII CCWGG 1 cut(s) 130
EcoT14I CCWWGG 1 cut(s) 191
EcoT22I ATGCAT 1 cut(s) 6
ErhI CCWWGG 1 cut(s) 191
FaeI CATG 4 cut(s) 38, 139, 149, 195
FaiI YATR 6 cut(s) 36, 137, 147, 193, 206, 216
FalI AAGNNNNNCTT 2 cut(s) 147, 179
FatI CATG 4 cut(s) 34, 135, 145, 191
Hin1II CATG 4 cut(s) 38, 139, 149, 195
HphI GGTGA 1 cut(s) 41
Hpy166II GTNNAC 2 cut(s) 32, 236
Hpy188I TCNGA 1 cut(s) 54
Hpy188III TCNNGA 1 cut(s) 251
Hpy8I GTNNAC 2 cut(s) 32, 236
HpyAV CCTTC 1 cut(s) 152
HpyCH4III ACNGT 1 cut(s) 240
HpyCH4IV ACGT 1 cut(s) 232
HpyCH4V TGCA 2 cut(s) 4, 47
HpyF10VI GCNNNNNNNGC 1 cut(s) 136
HpySE526I ACGT 1 cut(s) 232
Hsp92II CATG 4 cut(s) 38, 139, 149, 195
LmnI GCTCC 1 cut(s) 187
LpnPI CCDG 6 cut(s) 12, 43, 117, 144, 186, 236
MaeII ACGT 1 cut(s) 232
MaeIII GTNAC 1 cut(s) 141
MboII GAAGA 1 cut(s) 136
MhlI GDGCHC 1 cut(s) 184
MluCI AATT 2 cut(s) 48, 113
MnlI CCTC 4 cut(s) 80, 195, 231, 234
Mph1103I ATGCAT 1 cut(s) 6
MseI TTAA 3 cut(s) 15, 116, 201
MslI CAYNNNNRTG 1 cut(s) 39
MspR9I CCNGG 1 cut(s) 132
Mva1269I GAATGC 1 cut(s) 4
MvaI CCWGG 1 cut(s) 132
MwoI GCNNNNNNNGC 1 cut(s) 136
NcoI CCATGG 1 cut(s) 191
NlaIII CATG 4 cut(s) 38, 139, 149, 195
NmuCI GTSAC 1 cut(s) 141
NsiI ATGCAT 1 cut(s) 6
NspI RCATGY 1 cut(s) 139
PaeI GCATGC 1 cut(s) 139
PctI GAATGC 1 cut(s) 4
Psp6I CCWGG 1 cut(s) 130
PspGI CCWGG 1 cut(s) 130
PspPI GGNCC 1 cut(s) 218
RseI CAYNNNNRTG 1 cut(s) 39
SaqAI TTAA 3 cut(s) 15, 116, 201
Sau96I GGNCC 1 cut(s) 218
ScrFI CCNGG 1 cut(s) 132
SduI GDGCHC 1 cut(s) 184
SetI ASST 4 cut(s) 14, 111, 163, 235
SinI GGWCC 1 cut(s) 218
SmiMI CAYNNNNRTG 1 cut(s) 39
SphI GCATGC 1 cut(s) 139
Sse9I AATT 2 cut(s) 48, 113
SsiI CCGC 2 cut(s) 61, 188
StyD4I CCNGG 1 cut(s) 130
StyI CCWWGG 1 cut(s) 191
TaaI ACNGT 1 cut(s) 240
TaiI ACGT 1 cut(s) 235
TasI AATT 2 cut(s) 48, 113
Tru1I TTAA 3 cut(s) 15, 116, 201
Tru9I TTAA 3 cut(s) 15, 116, 201
TseFI GTSAC 1 cut(s) 141
Tsp45I GTSAC 1 cut(s) 141
TspDTI ATGAA 1 cut(s) 162
VpaK11BI GGWCC 1 cut(s) 218
XceI RCATGY 1 cut(s) 139
Zsp2I ATGCAT 1 cut(s) 6
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.