Rh4CG051000

splicing factor 3B subunit 2

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4C
Physical Location & Seq
Reverse (-)
10184501 .. 10185171
671 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4CG051000.1

Sequence Viewer

Length: 177 bp
ATGGGCAAAATGGATATTGATTATCAGGTCAAATTAAGAGAGAAGAAGCCAGGCATGCTGTCACATGAACTGAAAGAAGGTCTTGGTGTGCCAGATGGTGCTCCTCCGCCATGGCTCATTAACATACAGAGATATGGTCCTCCTCCATCACGTCCACAGTTGAAATCCCTGGACTGA

Protein Analysis

58

Amino Acids

6.52

Weight (kDa)

9.16

Isoelectric Point (pI)

46.7

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PSP PF04046 16 - 55 1.6e-14 PSP
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0022746)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr4g0393571
rosa_laevigata RLG00000009740
rosa_samantha Rh4BG044200 Rh4CG051000

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 107
AgsI TTSAA 1 cut(s) 163
AjiI CACGTC 1 cut(s) 152
AjnI CCWGG 2 cut(s) 49, 168
Alw21I GWGCWC 1 cut(s) 103
AspS9I GGNCC 1 cut(s) 137
AvaII GGWCC 1 cut(s) 137
Bbv12I GWGCWC 1 cut(s) 103
BccI CCATC 2 cut(s) 89, 154
BciT130I CCWGG 2 cut(s) 51, 170
Bme1390I CCNGG 2 cut(s) 51, 170
Bme18I GGWCC 1 cut(s) 137
BmgBI CACGTC 1 cut(s) 152
BmgT120I GGNCC 1 cut(s) 137
BmrFI CCNGG 2 cut(s) 51, 170
BsaJI CCNNGG 2 cut(s) 110, 168
BseBI CCWGG 2 cut(s) 51, 170
BseDI CCNNGG 2 cut(s) 110, 168
BseRI GAGGAG 2 cut(s) 93, 132
BsiHKAI GWGCWC 1 cut(s) 103
Bsp1286I GDGCHC 1 cut(s) 103
Bsp19I CCATGG 1 cut(s) 110
BspACI CCGC 1 cut(s) 107
BssECI CCNNGG 2 cut(s) 110, 168
BssT1I CCWWGG 1 cut(s) 110
Bst2UI CCWGG 2 cut(s) 51, 170
Bst4CI ACNGT 1 cut(s) 159
BstC8I GCNNGC 1 cut(s) 56
BstDSI CCRYGG 1 cut(s) 110
BstMWI GCNNNNNNNGC 1 cut(s) 55
BstNI CCWGG 2 cut(s) 51, 170
BstNSI RCATGY 1 cut(s) 58
BstSCI CCNGG 2 cut(s) 49, 168
BtgI CCRYGG 1 cut(s) 110
BtrI CACGTC 1 cut(s) 152
Cac8I GCNNGC 1 cut(s) 56
Cfr13I GGNCC 1 cut(s) 137
CviAII CATG 3 cut(s) 55, 65, 111
CviJI RGCY 2 cut(s) 49, 115
CviKI_1 RGCY 2 cut(s) 49, 115
EciI GGCGGA 1 cut(s) 96
Eco130I CCWWGG 1 cut(s) 110
Eco47I GGWCC 1 cut(s) 137
EcoRII CCWGG 2 cut(s) 49, 168
EcoT14I CCWWGG 1 cut(s) 110
ErhI CCWWGG 1 cut(s) 110
FaeI CATG 3 cut(s) 58, 68, 114
FaiI YATR 5 cut(s) 56, 66, 112, 125, 135
FalI AAGNNNNNCTT 2 cut(s) 66, 98
FatI CATG 3 cut(s) 54, 64, 110
Hin1II CATG 3 cut(s) 58, 68, 114
Hpy166II GTNNAC 1 cut(s) 155
Hpy8I GTNNAC 1 cut(s) 155
HpyAV CCTTC 1 cut(s) 71
HpyCH4III ACNGT 1 cut(s) 159
HpyCH4IV ACGT 1 cut(s) 151
HpyF10VI GCNNNNNNNGC 1 cut(s) 55
HpySE526I ACGT 1 cut(s) 151
Hsp92II CATG 3 cut(s) 58, 68, 114
LmnI GCTCC 1 cut(s) 106
LpnPI CCDG 5 cut(s) 11, 36, 63, 105, 155
MaeII ACGT 1 cut(s) 151
MaeIII GTNAC 1 cut(s) 60
MboII GAAGA 1 cut(s) 55
MhlI GDGCHC 1 cut(s) 103
MluCI AATT 1 cut(s) 32
MnlI CCTC 3 cut(s) 114, 150, 153
MseI TTAA 2 cut(s) 35, 120
MspR9I CCNGG 2 cut(s) 51, 170
MvaI CCWGG 2 cut(s) 51, 170
MwoI GCNNNNNNNGC 1 cut(s) 55
NcoI CCATGG 1 cut(s) 110
NlaIII CATG 3 cut(s) 58, 68, 114
NmuCI GTSAC 1 cut(s) 60
NspI RCATGY 1 cut(s) 58
PaeI GCATGC 1 cut(s) 58
Psp6I CCWGG 2 cut(s) 49, 168
PspGI CCWGG 2 cut(s) 49, 168
PspPI GGNCC 1 cut(s) 137
SaqAI TTAA 2 cut(s) 35, 120
Sau96I GGNCC 1 cut(s) 137
ScrFI CCNGG 2 cut(s) 51, 170
SduI GDGCHC 1 cut(s) 103
SetI ASST 3 cut(s) 30, 82, 154
SgeI CNNG 9 cut(s) 38, 62, 63, 67, 77, 95, 104, 123, 162
SinI GGWCC 1 cut(s) 137
SphI GCATGC 1 cut(s) 58
Sse9I AATT 1 cut(s) 32
SsiI CCGC 1 cut(s) 107
StyD4I CCNGG 2 cut(s) 49, 168
StyI CCWWGG 1 cut(s) 110
TaaI ACNGT 1 cut(s) 159
TaiI ACGT 1 cut(s) 154
TasI AATT 1 cut(s) 32
Tru1I TTAA 2 cut(s) 35, 120
Tru9I TTAA 2 cut(s) 35, 120
TseFI GTSAC 1 cut(s) 60
Tsp45I GTSAC 1 cut(s) 60
TspDTI ATGAA 1 cut(s) 81
VpaK11BI GGWCC 1 cut(s) 137
XceI RCATGY 1 cut(s) 58
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.