Rh4BG054400
BZIP Family

transcription factor

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4B
Physical Location & Seq
Forward (+)
9819209 .. 9821089
1881 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4BG054400.1

Sequence Viewer

Length: 270 bp
ATGGATTCACATACACTAAAGTCCGTGGCAGAGTTTCCTGGCTTCTTTAAGGGTAACACACCTGGCAGCATAGAAGCAGATGGTAAGCCATCTGAGGTAAAAGAAAAGTTACCGATCAAAACATCAAAAGTTAGCCTGGGCAGCTTAAACATGATTACCGGAAAGAATAATGAGCTTCCTAAAAAATCAAGAGTCTCGGCTAACGGAGTTTATTCTAAGAGGTGTTCTTATAATTCTTTAGTGACTATTGGCCTTTGCATGTGGAATTGA

Protein Analysis

89

Amino Acids

9.65

Weight (kDa)

9.55

Isoelectric Point (pI)

21.0

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
MFMR_assoc PF16596 35 - 76 1.7e-11 Disordered region downstream of MFMR
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0021462)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr6g0260881
rosa_rugosa Rorug07G0281300
rosa_samantha Rh4BG054400 Rh5CG314600 Rh6BG237800

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 231
AjnI CCWGG 3 cut(s) 37, 61, 135
AluBI AGCT 2 cut(s) 144, 175
AluI AGCT 2 cut(s) 144, 175
Alw26I GTCTC 1 cut(s) 199
AoxI GGCC 1 cut(s) 250
ApeKI GCWGC 2 cut(s) 66, 141
BbvI GCAGC 2 cut(s) 78, 153
BccI CCATC 2 cut(s) 74, 97
BciT130I CCWGG 3 cut(s) 39, 63, 137
BcoDI GTCTC 1 cut(s) 199
BisI GCNGC 2 cut(s) 67, 142
BlsI GCNGC 2 cut(s) 68, 143
Bme1390I CCNGG 3 cut(s) 39, 63, 137
BmrFI CCNGG 3 cut(s) 39, 63, 137
BsaJI CCNNGG 2 cut(s) 24, 136
BsaWI WCCGGW 1 cut(s) 158
BseBI CCWGG 3 cut(s) 39, 63, 137
BseDI CCNNGG 2 cut(s) 24, 136
BseMII CTCAG 1 cut(s) 84
BseXI GCAGC 2 cut(s) 78, 153
BshFI GGCC 1 cut(s) 252
BsiSI CCGG 1 cut(s) 159
BsmAI GTCTC 1 cut(s) 199
BsnI GGCC 1 cut(s) 252
Bsp143I GATC 1 cut(s) 114
BspANI GGCC 1 cut(s) 252
BspCNI CTCAG 1 cut(s) 85
BssECI CCNNGG 2 cut(s) 24, 136
BssMI GATC 1 cut(s) 114
Bst2UI CCWGG 3 cut(s) 39, 63, 137
BstDEI CTNAG 2 cut(s) 93, 216
BstDSI CCRYGG 1 cut(s) 24
BstKTI GATC 1 cut(s) 117
BstMAI GTCTC 1 cut(s) 199
BstMBI GATC 1 cut(s) 114
BstMWI GCNNNNNNNGC 1 cut(s) 141
BstNI CCWGG 3 cut(s) 39, 63, 137
BstNSI RCATGY 1 cut(s) 262
BstSCI CCNGG 3 cut(s) 37, 61, 135
BstV1I GCAGC 2 cut(s) 78, 153
BsuRI GGCC 1 cut(s) 252
BtgI CCRYGG 1 cut(s) 24
CviAII CATG 2 cut(s) 151, 259
CviJI RGCY 7 cut(s) 42, 88, 135, 144, 175, 200, 252
CviKI_1 RGCY 7 cut(s) 42, 88, 135, 144, 175, 200, 252
DdeI CTNAG 2 cut(s) 93, 216
DpnI GATC 1 cut(s) 116
DpnII GATC 1 cut(s) 114
EcoRII CCWGG 3 cut(s) 37, 61, 135
FaeI CATG 2 cut(s) 154, 262
FaiI YATR 5 cut(s) 12, 71, 152, 231, 260
FatI CATG 2 cut(s) 150, 258
Fnu4HI GCNGC 2 cut(s) 67, 142
Fsp4HI GCNGC 2 cut(s) 67, 142
GluI GCNGC 2 cut(s) 67, 142
HaeIII GGCC 1 cut(s) 252
HapII CCGG 1 cut(s) 159
Hin1II CATG 2 cut(s) 154, 262
HinfI GANTC 2 cut(s) 5, 192
HpaII CCGG 1 cut(s) 159
Hpy188I TCNGA 1 cut(s) 94
Hpy188III TCNNGA 1 cut(s) 189
HpyCH4V TGCA 1 cut(s) 258
HpyF10VI GCNNNNNNNGC 1 cut(s) 141
HpyF3I CTNAG 2 cut(s) 93, 216
Hsp92II CATG 2 cut(s) 154, 262
Kzo9I GATC 1 cut(s) 114
LpnPI CCDG 7 cut(s) 24, 48, 51, 75, 122, 149, 172
Lsp1109I GCAGC 2 cut(s) 78, 153
MaeIII GTNAC 3 cut(s) 53, 108, 241
MalI GATC 1 cut(s) 116
MboI GATC 1 cut(s) 114
MluCI AATT 2 cut(s) 232, 265
MlyI GAGTC 1 cut(s) 201
MnlI CCTC 2 cut(s) 88, 213
MseI TTAA 2 cut(s) 48, 146
MspI CCGG 1 cut(s) 159
MspR9I CCNGG 3 cut(s) 39, 63, 137
MvaI CCWGG 3 cut(s) 39, 63, 137
MwoI GCNNNNNNNGC 1 cut(s) 141
NdeII GATC 1 cut(s) 114
NlaIII CATG 2 cut(s) 154, 262
NmeAIII GCCGAG 1 cut(s) 176
NmuCI GTSAC 1 cut(s) 241
NspI RCATGY 1 cut(s) 262
PfeI GAWTC 1 cut(s) 5
PkrI GCNGC 2 cut(s) 68, 143
PleI GAGTC 1 cut(s) 200
PpsI GAGTC 1 cut(s) 200
PsiI TTATAA 1 cut(s) 231
Psp6I CCWGG 3 cut(s) 37, 61, 135
PspGI CCWGG 3 cut(s) 37, 61, 135
SaqAI TTAA 2 cut(s) 48, 146
SatI GCNGC 2 cut(s) 67, 142
Sau3AI GATC 1 cut(s) 114
SchI GAGTC 1 cut(s) 201
ScrFI CCNGG 3 cut(s) 39, 63, 137
SetI ASST 5 cut(s) 64, 99, 146, 177, 224
Sse9I AATT 2 cut(s) 232, 265
StyD4I CCNGG 3 cut(s) 37, 61, 135
TasI AATT 2 cut(s) 232, 265
TfiI GAWTC 1 cut(s) 5
Tru1I TTAA 2 cut(s) 48, 146
Tru9I TTAA 2 cut(s) 48, 146
TseFI GTSAC 1 cut(s) 241
TseI GCWGC 2 cut(s) 66, 141
Tsp45I GTSAC 1 cut(s) 241
TspGWI ACGGA 2 cut(s) 13, 219
XceI RCATGY 1 cut(s) 262
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.