Rh5CG314600
BZIP Family

transcription factor

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5C
Physical Location & Seq
Forward (+)
34795142 .. 34797326
2185 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5CG314600.1

Sequence Viewer

Length: 240 bp
ATGGCAAAGATCAAGGAAAGGTATAACACACCTGGCAGCATAGAAGCAGATGGTAAGCCATCTGAGGCAAAAGAAAAGTTACCGATCAAAACATCAAAAGTTAGCCTGGGCAGCTTAAACATGATTACCGGAAAGAATAATGAGCTTCCTAAAACATCAAGAGCCTCGGCTAATGGAGTTTATTCTAAGAGGTATTCTGATAATTCTTTAGTGACTATTGGCCTTTGCATGTGGAATTGA

Protein Analysis

79

Amino Acids

8.62

Weight (kDa)

9.67

Isoelectric Point (pI)

21.46

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
MFMR_assoc PF16596 25 - 64 2.2e-12 Disordered region downstream of MFMR
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0021462)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr6g0260881
rosa_rugosa Rorug07G0281300
rosa_samantha Rh4BG054400 Rh5CG314600 Rh6BG237800

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AjnI CCWGG 2 cut(s) 31, 105
AluBI AGCT 2 cut(s) 114, 145
AluI AGCT 2 cut(s) 114, 145
AoxI GGCC 1 cut(s) 220
ApeKI GCWGC 2 cut(s) 36, 111
BbvI GCAGC 2 cut(s) 48, 123
BccI CCATC 2 cut(s) 44, 67
BciT130I CCWGG 2 cut(s) 33, 107
BisI GCNGC 2 cut(s) 37, 112
BlsI GCNGC 2 cut(s) 38, 113
Bme1390I CCNGG 2 cut(s) 33, 107
BmrFI CCNGG 2 cut(s) 33, 107
BsaJI CCNNGG 2 cut(s) 106, 165
BsaWI WCCGGW 1 cut(s) 128
BseBI CCWGG 2 cut(s) 33, 107
BseDI CCNNGG 2 cut(s) 106, 165
BseMII CTCAG 1 cut(s) 54
BseXI GCAGC 2 cut(s) 48, 123
BshFI GGCC 1 cut(s) 222
BsiSI CCGG 1 cut(s) 129
BsnI GGCC 1 cut(s) 222
Bsp143I GATC 2 cut(s) 9, 84
BspANI GGCC 1 cut(s) 222
BspCNI CTCAG 1 cut(s) 55
BssECI CCNNGG 2 cut(s) 106, 165
BssMI GATC 2 cut(s) 9, 84
Bst2UI CCWGG 2 cut(s) 33, 107
BstDEI CTNAG 2 cut(s) 63, 186
BstKTI GATC 2 cut(s) 12, 87
BstMBI GATC 2 cut(s) 9, 84
BstMWI GCNNNNNNNGC 1 cut(s) 111
BstNI CCWGG 2 cut(s) 33, 107
BstNSI RCATGY 1 cut(s) 232
BstSCI CCNGG 2 cut(s) 31, 105
BstV1I GCAGC 2 cut(s) 48, 123
BsuRI GGCC 1 cut(s) 222
CviAII CATG 2 cut(s) 121, 229
CviJI RGCY 7 cut(s) 58, 105, 114, 145, 164, 170, 222
CviKI_1 RGCY 7 cut(s) 58, 105, 114, 145, 164, 170, 222
DdeI CTNAG 2 cut(s) 63, 186
DpnI GATC 2 cut(s) 11, 86
DpnII GATC 2 cut(s) 9, 84
EcoRII CCWGG 2 cut(s) 31, 105
FaeI CATG 2 cut(s) 124, 232
FaiI YATR 4 cut(s) 24, 41, 122, 230
FatI CATG 2 cut(s) 120, 228
Fnu4HI GCNGC 2 cut(s) 37, 112
Fsp4HI GCNGC 2 cut(s) 37, 112
GluI GCNGC 2 cut(s) 37, 112
HaeIII GGCC 1 cut(s) 222
HapII CCGG 1 cut(s) 129
Hin1II CATG 2 cut(s) 124, 232
HpaII CCGG 1 cut(s) 129
Hpy188I TCNGA 2 cut(s) 64, 199
Hpy188III TCNNGA 1 cut(s) 159
HpyCH4V TGCA 1 cut(s) 228
HpyF10VI GCNNNNNNNGC 1 cut(s) 111
HpyF3I CTNAG 2 cut(s) 63, 186
Hsp92II CATG 2 cut(s) 124, 232
Kzo9I GATC 2 cut(s) 9, 84
LpnPI CCDG 5 cut(s) 18, 45, 92, 119, 142
Lsp1109I GCAGC 2 cut(s) 48, 123
MaeIII GTNAC 2 cut(s) 78, 211
MalI GATC 2 cut(s) 11, 86
MboI GATC 2 cut(s) 9, 84
MluCI AATT 2 cut(s) 202, 235
MnlI CCTC 3 cut(s) 58, 175, 183
MseI TTAA 1 cut(s) 116
MspI CCGG 1 cut(s) 129
MspR9I CCNGG 2 cut(s) 33, 107
MvaI CCWGG 2 cut(s) 33, 107
MwoI GCNNNNNNNGC 1 cut(s) 111
NdeII GATC 2 cut(s) 9, 84
NlaIII CATG 2 cut(s) 124, 232
NmeAIII GCCGAG 1 cut(s) 146
NmuCI GTSAC 1 cut(s) 211
NspI RCATGY 1 cut(s) 232
PkrI GCNGC 2 cut(s) 38, 113
Psp6I CCWGG 2 cut(s) 31, 105
PspGI CCWGG 2 cut(s) 31, 105
SaqAI TTAA 1 cut(s) 116
SatI GCNGC 2 cut(s) 37, 112
Sau3AI GATC 2 cut(s) 9, 84
ScrFI CCNGG 2 cut(s) 33, 107
SetI ASST 5 cut(s) 23, 34, 116, 147, 194
SgeI CNNG 9 cut(s) 25, 44, 45, 118, 119, 133, 141, 171, 178
Sse9I AATT 2 cut(s) 202, 235
StyD4I CCNGG 2 cut(s) 31, 105
TasI AATT 2 cut(s) 202, 235
Tru1I TTAA 1 cut(s) 116
Tru9I TTAA 1 cut(s) 116
TseFI GTSAC 1 cut(s) 211
TseI GCWGC 2 cut(s) 36, 111
Tsp45I GTSAC 1 cut(s) 211
XceI RCATGY 1 cut(s) 232
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.