Rh4BG165700

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4B
OG0022904
Physical Location & Seq
Reverse (-)
29879106 .. 29880636
1531 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4BG165700.1

Sequence Viewer

Length: 390 bp
ATGCAACATGTCCAAATTTTGCTTTTCCTATATGATGAACGAGGATTTAAATGGACCAGGCTTCAATGCTTACTTCCTGATCAATATGCTATGGTGAAGCACTTCAGTGTCCTCTCCAATCCTGACATTAATTTGCCTACTAGAAATGTGTACCAATATGACATATTTATGTTGGAAACGCTTACTGGAAAGAGACCCGTTGCTAGTAATTCTGGCCCAGATAATTTCTCACATGTCAAAGCAATGCAACAAATCTCAAATGTTGACATTGTGGATGATTCTTTGAAGACAGAAGAAGGCTATAGTGGGGACATTTTCACTAACTTGGCTTCACTAGCACTTCAAATCTTAAGGGGCTTAAGTCAAGACATGAACAATATTGCAGCATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

129

Amino Acids

14.65

Weight (kDa)

5.16

Isoelectric Point (pI)

30.98

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0022904)

Species Orthologous Gene IDs
rosa_laevigata RLG00000014884
rosa_samantha Rh4AG169000 Rh4BG165700 Rh4CG180500

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 15
AcuI CTGAAG 1 cut(s) 88
AfaI GTAC 1 cut(s) 152
AflII CTTAAG 2 cut(s) 349, 358
AflIII ACRYGT 2 cut(s) 7, 232
AgsI TTSAA 3 cut(s) 65, 286, 344
AjnI CCWGG 1 cut(s) 56
AleI CACNNNNGTG 1 cut(s) 105
Alw26I GTCTC 1 cut(s) 187
AoxI GGCC 1 cut(s) 214
ApeKI GCWGC 1 cut(s) 383
ApoI RAATTY 1 cut(s) 15
AseI ATTAAT 1 cut(s) 129
Asp700I GAANNNNTTC 1 cut(s) 101
AspS9I GGNCC 2 cut(s) 54, 215
AsuHPI GGTGA 1 cut(s) 106
AvaII GGWCC 1 cut(s) 54
BbsI GAAGAC 1 cut(s) 293
BciT130I CCWGG 1 cut(s) 58
BclI TGATCA 1 cut(s) 79
BcoDI GTCTC 1 cut(s) 187
BfaI CTAG 3 cut(s) 141, 204, 335
BfmI CTRYAG 1 cut(s) 301
BfrI CTTAAG 2 cut(s) 349, 358
BisI GCNGC 1 cut(s) 384
BlsI GCNGC 1 cut(s) 385
Bme1390I CCNGG 1 cut(s) 58
Bme18I GGWCC 1 cut(s) 54
BmgT120I GGNCC 2 cut(s) 54, 215
BmrFI CCNGG 1 cut(s) 58
BpiI GAAGAC 1 cut(s) 293
BsaI GGTCTC 1 cut(s) 187
Bse1I ACTGG 1 cut(s) 190
Bse3DI GCAATG 1 cut(s) 249
BseBI CCWGG 1 cut(s) 58
BseGI GGATG 1 cut(s) 280
BseMI GCAATG 1 cut(s) 249
BseNI ACTGG 1 cut(s) 190
BshFI GGCC 1 cut(s) 216
BslFI GGGAC 1 cut(s) 323
BsmAI GTCTC 1 cut(s) 187
BsmFI GGGAC 1 cut(s) 323
BsnI GGCC 1 cut(s) 216
Bso31I GGTCTC 1 cut(s) 187
Bsp143I GATC 1 cut(s) 79
BspANI GGCC 1 cut(s) 216
BspTI CTTAAG 2 cut(s) 349, 358
BspTNI GGTCTC 1 cut(s) 187
BsrDI GCAATG 1 cut(s) 249
BsrI ACTGG 1 cut(s) 190
BssMI GATC 1 cut(s) 79
Bst2UI CCWGG 1 cut(s) 58
BstAFI CTTAAG 2 cut(s) 349, 358
BstF5I GGATG 1 cut(s) 280
BstKTI GATC 1 cut(s) 82
BstMAI GTCTC 1 cut(s) 187
BstMBI GATC 1 cut(s) 79
BstMWI GCNNNNNNNGC 1 cut(s) 335
BstNI CCWGG 1 cut(s) 58
BstNSI RCATGY 2 cut(s) 11, 236
BstSCI CCNGG 1 cut(s) 56
BstSFI CTRYAG 1 cut(s) 301
BstV2I GAAGAC 1 cut(s) 293
BsuRI GGCC 1 cut(s) 216
BtsCI GGATG 1 cut(s) 280
BtsIMutI CAGTG 1 cut(s) 112
Cfr13I GGNCC 2 cut(s) 54, 215
Csp6I GTAC 1 cut(s) 151
CviAII CATG 3 cut(s) 8, 233, 370
CviJI RGCY 5 cut(s) 61, 216, 300, 329, 357
CviKI_1 RGCY 5 cut(s) 61, 216, 300, 329, 357
CviQI GTAC 1 cut(s) 151
DpnI GATC 1 cut(s) 81
DpnII GATC 1 cut(s) 79
DraI TTTAAA 1 cut(s) 49
Eco31I GGTCTC 1 cut(s) 187
Eco47I GGWCC 1 cut(s) 54
Eco57I CTGAAG 1 cut(s) 88
EcoRII CCWGG 1 cut(s) 56
FaeI CATG 3 cut(s) 11, 236, 373
FaqI GGGAC 1 cut(s) 323
FatI CATG 3 cut(s) 7, 232, 369
FbaI TGATCA 1 cut(s) 79
Fnu4HI GCNGC 1 cut(s) 384
FokI GGATG 1 cut(s) 287
Fsp4HI GCNGC 1 cut(s) 384
FspBI CTAG 3 cut(s) 141, 204, 335
GluI GCNGC 1 cut(s) 384
HaeIII GGCC 1 cut(s) 216
Hin1II CATG 3 cut(s) 11, 236, 373
HincII GTYRAC 1 cut(s) 265
HindII GTYRAC 1 cut(s) 265
HinfI GANTC 1 cut(s) 278
HphI GGTGA 1 cut(s) 106
Hpy166II GTNNAC 2 cut(s) 151, 265
Hpy188III TCNNGA 3 cut(s) 77, 122, 365
Hpy8I GTNNAC 2 cut(s) 151, 265
HpyAV CCTTC 1 cut(s) 290
HpyCH4V TGCA 3 cut(s) 4, 247, 383
HpyF10VI GCNNNNNNNGC 1 cut(s) 335
Hsp92II CATG 3 cut(s) 11, 236, 373
Ksp22I TGATCA 1 cut(s) 79
Kzo9I GATC 1 cut(s) 79
LpnPI CCDG 7 cut(s) 43, 70, 90, 135, 171, 198, 231
MaeI CTAG 3 cut(s) 141, 204, 335
MalI GATC 1 cut(s) 81
MboI GATC 1 cut(s) 79
MboII GAAGA 2 cut(s) 298, 305
MluCI AATT 4 cut(s) 15, 130, 208, 223
MmeI TCCRAC 1 cut(s) 153
MnlI CCTC 2 cut(s) 35, 122
MroXI GAANNNNTTC 1 cut(s) 101
MseI TTAA 4 cut(s) 48, 129, 350, 359
MslI CAYNNNNRTG 2 cut(s) 105, 167
MspCI CTTAAG 2 cut(s) 349, 358
MspR9I CCNGG 1 cut(s) 58
MvaI CCWGG 1 cut(s) 58
MwoI GCNNNNNNNGC 1 cut(s) 335
NdeII GATC 1 cut(s) 79
NlaIII CATG 3 cut(s) 11, 236, 373
NspI RCATGY 2 cut(s) 11, 236
OliI CACNNNNGTG 1 cut(s) 105
PciI ACATGT 2 cut(s) 7, 232
PdmI GAANNNNTTC 1 cut(s) 101
PfeI GAWTC 1 cut(s) 278
PkrI GCNGC 1 cut(s) 385
PscI ACATGT 2 cut(s) 7, 232
PshBI ATTAAT 1 cut(s) 129
Psp6I CCWGG 1 cut(s) 56
PspGI CCWGG 1 cut(s) 56
PspPI GGNCC 2 cut(s) 54, 215
RsaI GTAC 1 cut(s) 152
RsaNI GTAC 1 cut(s) 151
RseI CAYNNNNRTG 2 cut(s) 105, 167
SaqAI TTAA 4 cut(s) 48, 129, 350, 359
SatI GCNGC 1 cut(s) 384
Sau3AI GATC 1 cut(s) 79
Sau96I GGNCC 2 cut(s) 54, 215
ScrFI CCNGG 1 cut(s) 58
SfcI CTRYAG 1 cut(s) 301
SinI GGWCC 1 cut(s) 54
SmiI ATTTAAAT 1 cut(s) 49
SmiMI CAYNNNNRTG 2 cut(s) 105, 167
SmlI CTYRAG 2 cut(s) 349, 358
SmoI CTYRAG 2 cut(s) 349, 358
Sse9I AATT 4 cut(s) 15, 130, 208, 223
SspI AATATT 1 cut(s) 379
SspMI CTAG 3 cut(s) 141, 204, 335
StyD4I CCNGG 1 cut(s) 56
SwaI ATTTAAAT 1 cut(s) 49
TasI AATT 4 cut(s) 15, 130, 208, 223
TfiI GAWTC 1 cut(s) 278
Tru1I TTAA 4 cut(s) 48, 129, 350, 359
Tru9I TTAA 4 cut(s) 48, 129, 350, 359
TscAI CASTG 1 cut(s) 112
TseI GCWGC 1 cut(s) 383
TspDTI ATGAA 2 cut(s) 51, 386
TspRI CASTG 1 cut(s) 112
Vha464I CTTAAG 2 cut(s) 349, 358
VpaK11BI GGWCC 1 cut(s) 54
VspI ATTAAT 1 cut(s) 129
XapI RAATTY 1 cut(s) 15
XceI RCATGY 2 cut(s) 11, 236
XmnI GAANNNNTTC 1 cut(s) 101
XspI CTAG 3 cut(s) 141, 204, 335
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.