Rh4CG180500

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4C
OG0022904
Physical Location & Seq
Reverse (-)
39137548 .. 39139077
1530 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4CG180500.1

Sequence Viewer

Length: 360 bp
ATGCAACATGTCCAAATTTTGCTTTTCCTATATGATGAACGAGGATTTAAATGGACCAGGCTTCAATGCTTACTTCCTGATCAGTATGCTATGGTGGAGCACTTCAATGTCCTCTCCAATCCTGACATCAGTTTGCCTATTAGAAATGTGTACCAATGTGACATATTTATGTTGGAAACGCTTACTGGAAAGAGACCCGTTGCTAGTAATTCTGGCCCAGATAATTTCTCACATGTCAAAGCAATGCAACAAATCTCAAATGATAACCTTGTGGATGATTCTTTGAAGACAGAAGAAGGCTATAGTGGGGACATTTTCACTAACTTGGCTTCACTAGCGCTTCAAATATATGGGGCTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

119

Amino Acids

13.53

Weight (kDa)

4.76

Isoelectric Point (pI)

23.07

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0022904)

Species Orthologous Gene IDs
rosa_laevigata RLG00000014884
rosa_samantha Rh4AG169000 Rh4BG165700 Rh4CG180500

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 15
AfaI GTAC 1 cut(s) 152
AfeI AGCGCT 1 cut(s) 339
AflIII ACRYGT 2 cut(s) 7, 232
AgsI TTSAA 4 cut(s) 65, 106, 286, 344
AjnI CCWGG 1 cut(s) 56
Alw21I GWGCWC 1 cut(s) 102
Alw26I GTCTC 1 cut(s) 187
Aor51HI AGCGCT 1 cut(s) 339
AoxI GGCC 1 cut(s) 214
ApoI RAATTY 1 cut(s) 15
AspLEI GCGC 1 cut(s) 340
AspS9I GGNCC 2 cut(s) 54, 215
AvaII GGWCC 1 cut(s) 54
BbsI GAAGAC 1 cut(s) 293
Bbv12I GWGCWC 1 cut(s) 102
BciT130I CCWGG 1 cut(s) 58
BclI TGATCA 1 cut(s) 79
BcoDI GTCTC 1 cut(s) 187
BfaI CTAG 2 cut(s) 204, 335
BfmI CTRYAG 1 cut(s) 301
BfoI RGCGCY 1 cut(s) 341
Bme1390I CCNGG 1 cut(s) 58
Bme18I GGWCC 1 cut(s) 54
BmgT120I GGNCC 2 cut(s) 54, 215
BmrFI CCNGG 1 cut(s) 58
BpiI GAAGAC 1 cut(s) 293
BsaI GGTCTC 1 cut(s) 187
Bse1I ACTGG 1 cut(s) 190
Bse3DI GCAATG 1 cut(s) 249
BseBI CCWGG 1 cut(s) 58
BseGI GGATG 1 cut(s) 280
BseMI GCAATG 1 cut(s) 249
BseNI ACTGG 1 cut(s) 190
BshFI GGCC 1 cut(s) 216
BsiHKAI GWGCWC 1 cut(s) 102
BslFI GGGAC 1 cut(s) 323
BsmAI GTCTC 1 cut(s) 187
BsmFI GGGAC 1 cut(s) 323
BsnI GGCC 1 cut(s) 216
Bso31I GGTCTC 1 cut(s) 187
Bsp1286I GDGCHC 1 cut(s) 102
Bsp143I GATC 1 cut(s) 79
BspANI GGCC 1 cut(s) 216
BspTNI GGTCTC 1 cut(s) 187
BsrDI GCAATG 1 cut(s) 249
BsrI ACTGG 1 cut(s) 190
BssMI GATC 1 cut(s) 79
Bst2UI CCWGG 1 cut(s) 58
BstF5I GGATG 1 cut(s) 280
BstH2I RGCGCY 1 cut(s) 341
BstHHI GCGC 1 cut(s) 340
BstKTI GATC 1 cut(s) 82
BstMAI GTCTC 1 cut(s) 187
BstMBI GATC 1 cut(s) 79
BstMWI GCNNNNNNNGC 1 cut(s) 335
BstNI CCWGG 1 cut(s) 58
BstNSI RCATGY 2 cut(s) 11, 236
BstSCI CCNGG 1 cut(s) 56
BstSFI CTRYAG 1 cut(s) 301
BstV2I GAAGAC 1 cut(s) 293
BsuRI GGCC 1 cut(s) 216
BtsCI GGATG 1 cut(s) 280
CfoI GCGC 1 cut(s) 340
Cfr13I GGNCC 2 cut(s) 54, 215
Csp6I GTAC 1 cut(s) 151
CviAII CATG 2 cut(s) 8, 233
CviJI RGCY 5 cut(s) 61, 216, 300, 329, 356
CviKI_1 RGCY 5 cut(s) 61, 216, 300, 329, 356
CviQI GTAC 1 cut(s) 151
DpnI GATC 1 cut(s) 81
DpnII GATC 1 cut(s) 79
DraI TTTAAA 1 cut(s) 49
Eco31I GGTCTC 1 cut(s) 187
Eco47I GGWCC 1 cut(s) 54
Eco47III AGCGCT 1 cut(s) 339
EcoRII CCWGG 1 cut(s) 56
FaeI CATG 2 cut(s) 11, 236
FaqI GGGAC 1 cut(s) 323
FatI CATG 2 cut(s) 7, 232
FbaI TGATCA 1 cut(s) 79
FokI GGATG 1 cut(s) 287
FspBI CTAG 2 cut(s) 204, 335
GlaI GCGC 1 cut(s) 339
HaeII RGCGCY 1 cut(s) 341
HaeIII GGCC 1 cut(s) 216
HhaI GCGC 1 cut(s) 340
Hin1II CATG 2 cut(s) 11, 236
Hin6I GCGC 1 cut(s) 338
HinP1I GCGC 1 cut(s) 338
HinfI GANTC 1 cut(s) 278
Hpy166II GTNNAC 1 cut(s) 151
Hpy188III TCNNGA 2 cut(s) 77, 122
Hpy8I GTNNAC 1 cut(s) 151
HpyAV CCTTC 1 cut(s) 290
HpyCH4V TGCA 2 cut(s) 4, 247
HpyF10VI GCNNNNNNNGC 1 cut(s) 335
Hsp92II CATG 2 cut(s) 11, 236
HspAI GCGC 1 cut(s) 338
Ksp22I TGATCA 1 cut(s) 79
Kzo9I GATC 1 cut(s) 79
LmnI GCTCC 1 cut(s) 97
LpnPI CCDG 7 cut(s) 43, 70, 90, 135, 171, 198, 231
MaeI CTAG 2 cut(s) 204, 335
MaeIII GTNAC 1 cut(s) 158
MalI GATC 1 cut(s) 81
MboI GATC 1 cut(s) 79
MboII GAAGA 2 cut(s) 298, 305
MhlI GDGCHC 1 cut(s) 102
MluCI AATT 3 cut(s) 15, 208, 223
MmeI TCCRAC 1 cut(s) 153
MnlI CCTC 2 cut(s) 35, 122
MseI TTAA 2 cut(s) 48, 358
MslI CAYNNNNRTG 2 cut(s) 105, 167
MspR9I CCNGG 1 cut(s) 58
MvaI CCWGG 1 cut(s) 58
MwoI GCNNNNNNNGC 1 cut(s) 335
NdeII GATC 1 cut(s) 79
NlaIII CATG 2 cut(s) 11, 236
NmuCI GTSAC 1 cut(s) 158
NspI RCATGY 2 cut(s) 11, 236
PciI ACATGT 2 cut(s) 7, 232
PfeI GAWTC 1 cut(s) 278
PscI ACATGT 2 cut(s) 7, 232
Psp6I CCWGG 1 cut(s) 56
PspGI CCWGG 1 cut(s) 56
PspPI GGNCC 2 cut(s) 54, 215
RsaI GTAC 1 cut(s) 152
RsaNI GTAC 1 cut(s) 151
RseI CAYNNNNRTG 2 cut(s) 105, 167
SaqAI TTAA 2 cut(s) 48, 358
Sau3AI GATC 1 cut(s) 79
Sau96I GGNCC 2 cut(s) 54, 215
ScrFI CCNGG 1 cut(s) 58
SduI GDGCHC 1 cut(s) 102
SetI ASST 1 cut(s) 270
SfcI CTRYAG 1 cut(s) 301
SinI GGWCC 1 cut(s) 54
SmiI ATTTAAAT 1 cut(s) 49
SmiMI CAYNNNNRTG 2 cut(s) 105, 167
Sse9I AATT 3 cut(s) 15, 208, 223
SspMI CTAG 2 cut(s) 204, 335
StyD4I CCNGG 1 cut(s) 56
SwaI ATTTAAAT 1 cut(s) 49
TasI AATT 3 cut(s) 15, 208, 223
TfiI GAWTC 1 cut(s) 278
Tru1I TTAA 2 cut(s) 48, 358
Tru9I TTAA 2 cut(s) 48, 358
TseFI GTSAC 1 cut(s) 158
Tsp45I GTSAC 1 cut(s) 158
TspDTI ATGAA 1 cut(s) 51
VpaK11BI GGWCC 1 cut(s) 54
XapI RAATTY 1 cut(s) 15
XceI RCATGY 2 cut(s) 11, 236
XspI CTAG 2 cut(s) 204, 335
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.