Rh4CG054000

60S ribosomal protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4C
Physical Location & Seq
Reverse (-)
10800367 .. 10802365
1999 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4CG054000.1

Sequence Viewer

Length: 276 bp
ATGGTGAGATCTCAAATGAATTTCAAGAGGCTTTCTCTCACTGACATCAAAATTGACATCAAGAGGGTCCCCAAGAAGAAGGAATTGCTTGCCGCAATGGAGGCTGCTGATGTTAAGAAGAAGTGGGAAAGTAGCTCTTGGGGTAGGAAGCTTATTGTTCAGAAGCGAAGGGCCAATCTTAATGACTTTGATCGCTTCAAGCTTATGTTGGCCAAGATCAAGAGGGCTGGCCTGGTCAAGAGCGAACTTGCAAAACTGAAGAAGCAGAGTGCTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

91

Amino Acids

10.6

Weight (kDa)

10.8

Isoelectric Point (pI)

38.18

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Ribosomal_L14e PF01929 3 - 75 6.7e-27 Ribosomal protein L14
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0021282)

Species Orthologous Gene IDs
pyrus_communis pycom13g18920
rosa_multiflora Rmu_co8287205.1_g000001 Rmu_co8313979.1_g000001
rosa_samantha Rh4CG054000 Rh4CG057600

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 93
AcoI YGGCCR 1 cut(s) 210
AcsI RAATTY 1 cut(s) 19
AgsI TTSAA 2 cut(s) 25, 199
AjnI CCWGG 1 cut(s) 231
AluBI AGCT 3 cut(s) 135, 151, 202
AluI AGCT 3 cut(s) 135, 151, 202
AoxI GGCC 3 cut(s) 171, 210, 229
ApeKI GCWGC 1 cut(s) 104
ApoI RAATTY 1 cut(s) 19
AspS9I GGNCC 2 cut(s) 67, 171
AsuHPI GGTGA 1 cut(s) 16
AvaII GGWCC 1 cut(s) 67
BalI TGGCCA 1 cut(s) 212
BbvI GCAGC 1 cut(s) 91
BciT130I CCWGG 1 cut(s) 233
BglII AGATCT 1 cut(s) 8
BisI GCNGC 2 cut(s) 93, 105
BlsI GCNGC 2 cut(s) 94, 106
Bme1390I CCNGG 1 cut(s) 233
Bme18I GGWCC 1 cut(s) 67
BmgT120I GGNCC 2 cut(s) 67, 171
BmiI GGNNCC 2 cut(s) 68, 69
BmrFI CCNGG 1 cut(s) 233
BplI GAGNNNNNCTC 2 cut(s) 19, 51
Bse3DI GCAATG 1 cut(s) 102
BseBI CCWGG 1 cut(s) 233
BseMI GCAATG 1 cut(s) 102
BseXI GCAGC 1 cut(s) 91
BshFI GGCC 3 cut(s) 173, 212, 231
BslFI GGGAC 1 cut(s) 53
BsmFI GGGAC 1 cut(s) 53
BsnI GGCC 3 cut(s) 173, 212, 231
Bsp143I GATC 3 cut(s) 8, 190, 216
BspACI CCGC 1 cut(s) 93
BspANI GGCC 3 cut(s) 173, 212, 231
BspLI GGNNCC 2 cut(s) 68, 69
BsrDI GCAATG 1 cut(s) 102
BssMI GATC 3 cut(s) 8, 190, 216
Bst2UI CCWGG 1 cut(s) 233
BstC8I GCNNGC 2 cut(s) 90, 229
BstDEI CTNAG 1 cut(s) 273
BstKTI GATC 3 cut(s) 11, 193, 219
BstMBI GATC 3 cut(s) 8, 190, 216
BstMWI GCNNNNNNNGC 1 cut(s) 101
BstNI CCWGG 1 cut(s) 233
BstSCI CCNGG 1 cut(s) 231
BstV1I GCAGC 1 cut(s) 91
BstX2I RGATCY 1 cut(s) 8
BstYI RGATCY 1 cut(s) 8
BsuRI GGCC 3 cut(s) 173, 212, 231
BtsIMutI CAGTG 1 cut(s) 39
Cac8I GCNNGC 2 cut(s) 90, 229
Cfr13I GGNCC 2 cut(s) 67, 171
CviJI RGCY 9 cut(s) 31, 104, 135, 151, 173, 202, 212, 227, 231
CviKI_1 RGCY 9 cut(s) 31, 104, 135, 151, 173, 202, 212, 227, 231
DdeI CTNAG 1 cut(s) 273
DpnI GATC 3 cut(s) 10, 192, 218
DpnII GATC 3 cut(s) 8, 190, 216
EaeI YGGCCR 1 cut(s) 210
Eco47I GGWCC 1 cut(s) 67
EcoO109I RGGNCCY 1 cut(s) 67
EcoRII CCWGG 1 cut(s) 231
FaiI YATR 1 cut(s) 206
FalI AAGNNNNNCTT 2 cut(s) 121, 153
FaqI GGGAC 1 cut(s) 53
Fnu4HI GCNGC 2 cut(s) 93, 105
Fsp4HI GCNGC 2 cut(s) 93, 105
GluI GCNGC 2 cut(s) 93, 105
HaeIII GGCC 3 cut(s) 173, 212, 231
HindIII AAGCTT 2 cut(s) 149, 200
HphI GGTGA 1 cut(s) 16
Hpy188I TCNGA 1 cut(s) 162
Hpy188III TCNNGA 4 cut(s) 25, 61, 220, 238
HpyAV CCTTC 2 cut(s) 73, 162
HpyCH4V TGCA 1 cut(s) 251
HpyF10VI GCNNNNNNNGC 1 cut(s) 101
HpyF3I CTNAG 1 cut(s) 273
KflI GGGWCCC 1 cut(s) 67
Kzo9I GATC 3 cut(s) 8, 190, 216
LpnPI CCDG 3 cut(s) 213, 218, 245
Lsp1109I GCAGC 1 cut(s) 91
MalI GATC 3 cut(s) 10, 192, 218
MboI GATC 3 cut(s) 8, 190, 216
MboII GAAGA 3 cut(s) 88, 130, 271
MflI RGATCY 1 cut(s) 8
MlsI TGGCCA 1 cut(s) 212
MluCI AATT 3 cut(s) 19, 51, 83
MluNI TGGCCA 1 cut(s) 212
MnlI CCTC 4 cut(s) 21, 57, 94, 216
Mox20I TGGCCA 1 cut(s) 212
MscI TGGCCA 1 cut(s) 212
MseI TTAA 2 cut(s) 114, 180
Msp20I TGGCCA 1 cut(s) 212
MspR9I CCNGG 1 cut(s) 233
MvaI CCWGG 1 cut(s) 233
MwoI GCNNNNNNNGC 1 cut(s) 101
NdeII GATC 3 cut(s) 8, 190, 216
NlaIV GGNNCC 2 cut(s) 68, 69
PkrI GCNGC 2 cut(s) 94, 106
PpuMI RGGWCCY 1 cut(s) 67
Psp5II RGGWCCY 1 cut(s) 67
Psp6I CCWGG 1 cut(s) 231
PspGI CCWGG 1 cut(s) 231
PspN4I GGNNCC 2 cut(s) 68, 69
PspPI GGNCC 2 cut(s) 67, 171
PspPPI RGGWCCY 1 cut(s) 67
PsuI RGATCY 1 cut(s) 8
SaqAI TTAA 2 cut(s) 114, 180
SatI GCNGC 2 cut(s) 93, 105
Sau3AI GATC 3 cut(s) 8, 190, 216
Sau96I GGNCC 2 cut(s) 67, 171
ScrFI CCNGG 1 cut(s) 233
SetI ASST 3 cut(s) 137, 153, 204
SinI GGWCC 1 cut(s) 67
Sse9I AATT 3 cut(s) 19, 51, 83
SsiI CCGC 1 cut(s) 93
StyD4I CCNGG 1 cut(s) 231
TasI AATT 3 cut(s) 19, 51, 83
TauI GCSGC 1 cut(s) 95
Tru1I TTAA 2 cut(s) 114, 180
Tru9I TTAA 2 cut(s) 114, 180
TscAI CASTG 1 cut(s) 46
TseI GCWGC 1 cut(s) 104
TspDTI ATGAA 1 cut(s) 32
TspRI CASTG 1 cut(s) 46
VpaK11BI GGWCC 1 cut(s) 67
XapI RAATTY 1 cut(s) 19
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.