Rh4CG201600

L-type lectin-domain containing receptor kinase IX.1-like

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4C
Physical Location & Seq
Forward (+)
42700768 .. 42700917
150 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4CG201600.1

Sequence Viewer

Length: 150 bp
ATGAAGGTTCTTCAGCTTGAAGCACCATTGCCAGAACTTCCAAGGGACATGCATGATCATTCAGTACAACCTGAACATCAACTACAAACTCAGGCTGCTTCCTCTCAGATATCCTTAACTTCTTCTAGCCTTGTTACTGTGGGCCGTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

49

Amino Acids

5.39

Weight (kDa)

5.76

Isoelectric Point (pI)

63.52

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0021643)

Species Orthologous Gene IDs
rosa_multiflora Rmu_sc0001217.1_g000024
rosa_roxburghii Rroxscaffold_4G00298830
rosa_rugosa Rorug05G0567300
rosa_samantha Rh4CG201600 Rh4DG188400

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 66
AgsI TTSAA 1 cut(s) 20
AluBI AGCT 1 cut(s) 16
AluI AGCT 1 cut(s) 16
AoxI GGCC 1 cut(s) 142
ApeKI GCWGC 1 cut(s) 95
AspS9I GGNCC 1 cut(s) 142
BbvI GCAGC 1 cut(s) 82
BceAI ACGGC 1 cut(s) 129
BclI TGATCA 1 cut(s) 55
BfaI CTAG 1 cut(s) 126
BisI GCNGC 1 cut(s) 96
BlsI GCNGC 1 cut(s) 97
BmgT120I GGNCC 1 cut(s) 142
BsaJI CCNNGG 1 cut(s) 41
Bse3DI GCAATG 1 cut(s) 26
BseDI CCNNGG 1 cut(s) 41
BseMI GCAATG 1 cut(s) 26
BseMII CTCAG 2 cut(s) 104, 119
BseXI GCAGC 1 cut(s) 82
BshFI GGCC 1 cut(s) 144
BslFI GGGAC 1 cut(s) 59
BsmFI GGGAC 1 cut(s) 59
BsnI GGCC 1 cut(s) 144
Bsp143I GATC 1 cut(s) 55
BspANI GGCC 1 cut(s) 144
BspCNI CTCAG 2 cut(s) 103, 118
BsrDI GCAATG 1 cut(s) 26
BssECI CCNNGG 1 cut(s) 41
BssMI GATC 1 cut(s) 55
BssT1I CCWWGG 1 cut(s) 41
Bst4CI ACNGT 1 cut(s) 139
BstDEI CTNAG 2 cut(s) 90, 105
BstKTI GATC 1 cut(s) 58
BstMBI GATC 1 cut(s) 55
BstNSI RCATGY 1 cut(s) 52
BstV1I GCAGC 1 cut(s) 82
BsuRI GGCC 1 cut(s) 144
Cfr13I GGNCC 1 cut(s) 142
Csp6I GTAC 1 cut(s) 65
CviAII CATG 2 cut(s) 49, 53
CviJI RGCY 4 cut(s) 16, 95, 129, 144
CviKI_1 RGCY 4 cut(s) 16, 95, 129, 144
CviQI GTAC 1 cut(s) 65
DdeI CTNAG 2 cut(s) 90, 105
DpnI GATC 1 cut(s) 57
DpnII GATC 1 cut(s) 55
Eco130I CCWWGG 1 cut(s) 41
Eco32I GATATC 1 cut(s) 111
EcoRV GATATC 1 cut(s) 111
EcoT14I CCWWGG 1 cut(s) 41
EcoT22I ATGCAT 1 cut(s) 54
ErhI CCWWGG 1 cut(s) 41
FaeI CATG 2 cut(s) 52, 56
FaiI YATR 2 cut(s) 50, 54
FaqI GGGAC 1 cut(s) 59
FatI CATG 2 cut(s) 48, 52
FbaI TGATCA 1 cut(s) 55
Fnu4HI GCNGC 1 cut(s) 96
Fsp4HI GCNGC 1 cut(s) 96
FspBI CTAG 1 cut(s) 126
GluI GCNGC 1 cut(s) 96
HaeIII GGCC 1 cut(s) 144
Hin1II CATG 2 cut(s) 52, 56
Hpy188I TCNGA 1 cut(s) 108
HpyCH4III ACNGT 1 cut(s) 139
HpyCH4V TGCA 1 cut(s) 52
HpyF3I CTNAG 2 cut(s) 90, 105
Hsp92II CATG 2 cut(s) 52, 56
Ksp22I TGATCA 1 cut(s) 55
Kzo9I GATC 1 cut(s) 55
LpnPI CCDG 3 cut(s) 45, 77, 84
Lsp1109I GCAGC 1 cut(s) 82
MaeI CTAG 1 cut(s) 126
MaeIII GTNAC 1 cut(s) 133
MalI GATC 1 cut(s) 57
MboI GATC 1 cut(s) 55
MboII GAAGA 1 cut(s) 114
MnlI CCTC 1 cut(s) 112
Mph1103I ATGCAT 1 cut(s) 54
MseI TTAA 2 cut(s) 116, 148
NdeII GATC 1 cut(s) 55
NlaIII CATG 2 cut(s) 52, 56
NsiI ATGCAT 1 cut(s) 54
NspI RCATGY 1 cut(s) 52
PkrI GCNGC 1 cut(s) 97
PspPI GGNCC 1 cut(s) 142
PsrI GAACNNNNNNTAC 2 cut(s) 66, 98
RsaI GTAC 1 cut(s) 66
RsaNI GTAC 1 cut(s) 65
SaqAI TTAA 2 cut(s) 116, 148
SatI GCNGC 1 cut(s) 96
Sau3AI GATC 1 cut(s) 55
Sau96I GGNCC 1 cut(s) 142
SetI ASST 3 cut(s) 9, 18, 73
SgeI CNNG 9 cut(s) 29, 44, 54, 61, 65, 83, 104, 138, 143
SspMI CTAG 1 cut(s) 126
StyI CCWWGG 1 cut(s) 41
TaaI ACNGT 1 cut(s) 139
TatI WGTACW 1 cut(s) 64
Tru1I TTAA 2 cut(s) 116, 148
Tru9I TTAA 2 cut(s) 116, 148
TseI GCWGC 1 cut(s) 95
TspDTI ATGAA 1 cut(s) 17
XceI RCATGY 1 cut(s) 52
XspI CTAG 1 cut(s) 126
Zsp2I ATGCAT 1 cut(s) 54
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.