Rh4DG223400

Inosine-uridine preferring nucleoside hydrolase

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4D
Physical Location & Seq
Reverse (-)
42653638 .. 42654345
708 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4DG223400.1

Sequence Viewer

Length: 219 bp
ATGGGAACTTTCTTGGGGAAACTTCTTGGTGCAGTTCTCTTGGACGGTGATTCTCATCTGAGCCAAAGCTTCAAACTCAAGCACATCAAAGTTTTTGCTGATGATATTGAATCCAGAGATGGGGAAATTTTGATTCATCAAAATCAAGGAAAATTAGTCAAAGTATCGGACAAAGTAAATCCCAGGGCATATTATAAACTTTTCGCAGAAACGGCTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

72

Amino Acids

8.02

Weight (kDa)

8.04

Isoelectric Point (pI)

25.64

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0020541)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr4g0420381
rosa_multiflora Rmu_sc0002248.1_g000006
rosa_roxburghii Rroxscaffold_5G00363020
rosa_samantha Rh4AG224900 Rh4CG239300 Rh4DG223400

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 195
AcsI RAATTY 1 cut(s) 126
AfiI CCNNNNNNNGG 1 cut(s) 120
AgsI TTSAA 2 cut(s) 73, 110
AjnI CCWGG 1 cut(s) 182
AluBI AGCT 1 cut(s) 69
AluI AGCT 1 cut(s) 69
ApoI RAATTY 1 cut(s) 126
AsuHPI GGTGA 1 cut(s) 59
BccI CCATC 1 cut(s) 113
BciT130I CCWGG 1 cut(s) 184
Bme1390I CCNGG 1 cut(s) 184
BmrFI CCNGG 1 cut(s) 184
BpuEI CTTGAG 1 cut(s) 62
BsaBI GATNNNNATC 1 cut(s) 54
BsaJI CCNNGG 2 cut(s) 182, 183
Bsc4I CCNNNNNNNGG 1 cut(s) 120
Bse8I GATNNNNATC 1 cut(s) 54
BseBI CCWGG 1 cut(s) 184
BseDI CCNNGG 2 cut(s) 182, 183
BseJI GATNNNNATC 1 cut(s) 54
BseLI CCNNNNNNNGG 1 cut(s) 120
BseMII CTCAG 1 cut(s) 50
BsgI GTGCAG 1 cut(s) 51
BslI CCNNNNNNNGG 1 cut(s) 120
BspCNI CTCAG 1 cut(s) 51
BssECI CCNNGG 2 cut(s) 182, 183
Bst2UI CCWGG 1 cut(s) 184
Bst4CI ACNGT 1 cut(s) 47
BstDEI CTNAG 2 cut(s) 59, 216
BstMWI GCNNNNNNNGC 1 cut(s) 212
BstNI CCWGG 1 cut(s) 184
BstSCI CCNGG 1 cut(s) 182
CviJI RGCY 3 cut(s) 63, 69, 215
CviKI_1 RGCY 3 cut(s) 63, 69, 215
DdeI CTNAG 2 cut(s) 59, 216
EcoRII CCWGG 1 cut(s) 182
FaiI YATR 2 cut(s) 190, 195
HindIII AAGCTT 1 cut(s) 67
HinfI GANTC 3 cut(s) 50, 110, 133
HphI GGTGA 1 cut(s) 59
Hpy188I TCNGA 2 cut(s) 60, 169
Hpy188III TCNNGA 1 cut(s) 114
HpyCH4III ACNGT 1 cut(s) 47
HpyCH4V TGCA 1 cut(s) 32
HpyF10VI GCNNNNNNNGC 1 cut(s) 212
HpyF3I CTNAG 2 cut(s) 59, 216
LpnPI CCDG 3 cut(s) 127, 169, 196
MluCI AATT 2 cut(s) 126, 152
MspR9I CCNGG 1 cut(s) 184
MvaI CCWGG 1 cut(s) 184
MwoI GCNNNNNNNGC 1 cut(s) 212
PasI CCCWGGG 1 cut(s) 183
PfeI GAWTC 3 cut(s) 50, 110, 133
PsiI TTATAA 1 cut(s) 195
Psp6I CCWGG 1 cut(s) 182
PspGI CCWGG 1 cut(s) 182
ScrFI CCNGG 1 cut(s) 184
SetI ASST 1 cut(s) 71
SgeI CNNG 8 cut(s) 25, 38, 52, 91, 126, 158, 195, 196
SmlI CTYRAG 1 cut(s) 77
SmoI CTYRAG 1 cut(s) 77
Sse9I AATT 2 cut(s) 126, 152
StyD4I CCNGG 1 cut(s) 182
TaaI ACNGT 1 cut(s) 47
TasI AATT 2 cut(s) 126, 152
TfiI GAWTC 3 cut(s) 50, 110, 133
TspDTI ATGAA 1 cut(s) 125
XapI RAATTY 1 cut(s) 126
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.