Rh4DG267100

Cell wall vacuolar inhibitor of fructosidase 1-like

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4D
Physical Location & Seq
Reverse (-)
48647305 .. 48648232
928 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4DG267100.1

Sequence Viewer

Length: 546 bp
ATGAAGATCATTTCAATATCTCTACCACTACTAACCATATTTATCATTCAAAATGTGTTTCTTCCAATAAGCCATTGCAGGGCTGATCTCATTGACCAAACGTGCAAACAAACACCGAACTACAATCTTTGTGTTTCTTCTCTTAAATCTAATCCTCGAAGCTCCGCTGCTGATGTCAAGGGCCTAGCCATCATAATGGTCGAGGTGGTTAAGTCCAAGGCAAATGATACTCTGAACAAAATATGGGCAGAGCTTCTTAGGCATGAAGACCCCGTAATCAGAAATTGCTATGATCATTACGGTTACATGGTGGGAGCTTTTATCCCAGACATCTATGGAGATTTAACTTCAAGAGGTTTAGGTGGTAGGTTTGTACGTTACAACCCTGCACAGGCAGAGCGACGCTTGCAAAATGATATTATCCTACGGGTTGATCATTGTCAGAATGGTTTTGGTCAAGGCCGCCGATCTCCATTCGCCAAGGAAAACAGAGCTACCCGTGAAGCAGCGGTTGTGGCTGCAGCAATTGTTTGGATATTGATCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

181

Amino Acids

20.3

Weight (kDa)

9.2

Isoelectric Point (pI)

37.94

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PMEI PF04043 29 - 151 1.6e-14 Plant invertase/pectin methylesterase inhibitor
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0016824)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 3 cut(s) 165, 463, 509
AfaI GTAC 1 cut(s) 375
AfiI CCNNNNNNNGG 2 cut(s) 79, 391
AgsI TTSAA 3 cut(s) 15, 50, 351
AluBI AGCT 4 cut(s) 162, 253, 317, 494
AluI AGCT 4 cut(s) 162, 253, 317, 494
AoxI GGCC 2 cut(s) 181, 460
ApeKI GCWGC 4 cut(s) 167, 506, 518, 521
AspS9I GGNCC 1 cut(s) 181
BbsI GAAGAC 1 cut(s) 273
BbvI GCAGC 4 cut(s) 154, 505, 518, 533
BccI CCATC 1 cut(s) 197
BclI TGATCA 2 cut(s) 292, 433
BfaI CTAG 1 cut(s) 185
BfmI CTRYAG 1 cut(s) 519
BisI GCNGC 5 cut(s) 168, 463, 507, 519, 522
BlsI GCNGC 5 cut(s) 169, 464, 508, 520, 523
BmgT120I GGNCC 1 cut(s) 181
BpiI GAAGAC 1 cut(s) 273
BsaBI GATNNNNATC 1 cut(s) 539
BsaJI CCNNGG 2 cut(s) 216, 480
Bsc4I CCNNNNNNNGG 2 cut(s) 79, 391
Bse3DI GCAATG 1 cut(s) 73
Bse8I GATNNNNATC 1 cut(s) 539
BseDI CCNNGG 2 cut(s) 216, 480
BseJI GATNNNNATC 1 cut(s) 539
BseLI CCNNNNNNNGG 2 cut(s) 79, 391
BseMI GCAATG 1 cut(s) 73
BseXI GCAGC 4 cut(s) 154, 505, 518, 533
BsgI GTGCAG 1 cut(s) 372
BshFI GGCC 2 cut(s) 183, 462
BslI CCNNNNNNNGG 2 cut(s) 79, 391
BsnI GGCC 2 cut(s) 183, 462
Bsp143I GATC 6 cut(s) 6, 85, 292, 433, 467, 540
BspACI CCGC 3 cut(s) 165, 463, 509
BspANI GGCC 2 cut(s) 183, 462
BspMAI CTGCAG 1 cut(s) 523
BsrDI GCAATG 1 cut(s) 73
BssECI CCNNGG 2 cut(s) 216, 480
BssMI GATC 6 cut(s) 6, 85, 292, 433, 467, 540
BssT1I CCWWGG 2 cut(s) 216, 480
Bst4CI ACNGT 1 cut(s) 302
BstC8I GCNNGC 1 cut(s) 407
BstDEI CTNAG 1 cut(s) 257
BstKTI GATC 6 cut(s) 9, 88, 295, 436, 470, 543
BstMBI GATC 6 cut(s) 6, 85, 292, 433, 467, 540
BstMWI GCNNNNNNNGC 3 cut(s) 259, 406, 515
BstSFI CTRYAG 1 cut(s) 519
BstV1I GCAGC 4 cut(s) 154, 505, 518, 533
BstV2I GAAGAC 1 cut(s) 273
BstXI CCANNNNNNTGG 1 cut(s) 196
BsuRI GGCC 2 cut(s) 183, 462
Cac8I GCNNGC 1 cut(s) 407
Cfr13I GGNCC 1 cut(s) 181
CseI GACGC 1 cut(s) 411
Csp6I GTAC 1 cut(s) 374
CviAII CATG 2 cut(s) 263, 307
CviQI GTAC 1 cut(s) 374
DdeI CTNAG 1 cut(s) 257
DpnI GATC 6 cut(s) 8, 87, 294, 435, 469, 542
DpnII GATC 6 cut(s) 6, 85, 292, 433, 467, 540
Eco130I CCWWGG 2 cut(s) 216, 480
EcoO109I RGGNCCY 1 cut(s) 181
EcoT14I CCWWGG 2 cut(s) 216, 480
ErhI CCWWGG 2 cut(s) 216, 480
FaeI CATG 2 cut(s) 266, 310
FaiI YATR 7 cut(s) 38, 194, 244, 264, 291, 308, 336
FatI CATG 2 cut(s) 262, 306
FbaI TGATCA 2 cut(s) 292, 433
Fnu4HI GCNGC 5 cut(s) 168, 463, 507, 519, 522
Fsp4HI GCNGC 5 cut(s) 168, 463, 507, 519, 522
FspBI CTAG 1 cut(s) 185
GluI GCNGC 5 cut(s) 168, 463, 507, 519, 522
HaeIII GGCC 2 cut(s) 183, 462
HgaI GACGC 1 cut(s) 411
Hin1II CATG 2 cut(s) 266, 310
Hpy188I TCNGA 4 cut(s) 234, 281, 444, 545
Hpy188III TCNNGA 1 cut(s) 351
Hpy99I CGWCG 1 cut(s) 405
HpyCH4III ACNGT 1 cut(s) 302
HpyCH4IV ACGT 2 cut(s) 101, 376
HpyCH4V TGCA 5 cut(s) 78, 105, 389, 409, 521
HpyF10VI GCNNNNNNNGC 3 cut(s) 259, 406, 515
HpyF3I CTNAG 1 cut(s) 257
HpySE526I ACGT 2 cut(s) 101, 376
Hsp92II CATG 2 cut(s) 266, 310
Ksp22I TGATCA 2 cut(s) 292, 433
Kzo9I GATC 6 cut(s) 6, 85, 292, 433, 467, 540
LmnI GCTCC 2 cut(s) 167, 314
LpnPI CCDG 4 cut(s) 64, 339, 377, 399
Lsp1109I GCAGC 4 cut(s) 154, 505, 518, 533
MaeI CTAG 1 cut(s) 185
MaeII ACGT 2 cut(s) 101, 376
MaeIII GTNAC 2 cut(s) 302, 377
MalI GATC 6 cut(s) 8, 87, 294, 435, 469, 542
MboI GATC 6 cut(s) 6, 85, 292, 433, 467, 540
MboII GAAGA 4 cut(s) 16, 53, 129, 278
MfeI CAATTG 1 cut(s) 525
MluCI AATT 2 cut(s) 283, 525
MnlI CCTC 3 cut(s) 165, 196, 347
MseI TTAA 3 cut(s) 144, 210, 344
MslI CAYNNNNRTG 1 cut(s) 194
MspA1I CMGCKG 2 cut(s) 167, 509
MunI CAATTG 1 cut(s) 525
MwoI GCNNNNNNNGC 3 cut(s) 259, 406, 515
NdeII GATC 6 cut(s) 6, 85, 292, 433, 467, 540
NlaIII CATG 2 cut(s) 266, 310
PkrI GCNGC 5 cut(s) 169, 464, 508, 520, 523
PspPI GGNCC 1 cut(s) 181
PstI CTGCAG 1 cut(s) 523
RsaI GTAC 1 cut(s) 375
RsaNI GTAC 1 cut(s) 374
RseI CAYNNNNRTG 1 cut(s) 194
SaqAI TTAA 3 cut(s) 144, 210, 344
SatI GCNGC 5 cut(s) 168, 463, 507, 519, 522
Sau3AI GATC 6 cut(s) 6, 85, 292, 433, 467, 540
Sau96I GGNCC 1 cut(s) 181
SfcI CTRYAG 1 cut(s) 519
SmiMI CAYNNNNRTG 1 cut(s) 194
Sse9I AATT 2 cut(s) 283, 525
SsiI CCGC 3 cut(s) 165, 463, 509
SspMI CTAG 1 cut(s) 185
StyI CCWWGG 2 cut(s) 216, 480
TaaI ACNGT 1 cut(s) 302
TaiI ACGT 2 cut(s) 104, 379
TaqI TCGA 2 cut(s) 157, 201
TasI AATT 2 cut(s) 283, 525
TauI GCSGC 1 cut(s) 465
Tru1I TTAA 3 cut(s) 144, 210, 344
Tru9I TTAA 3 cut(s) 144, 210, 344
TseI GCWGC 4 cut(s) 167, 506, 518, 521
TspDTI ATGAA 2 cut(s) 17, 279
XspI CTAG 1 cut(s) 185
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.