Rh5AG482300

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5A
OG0021663
Physical Location & Seq
Forward (+)
82609014 .. 82609479
466 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5AG482300.1

Sequence Viewer

Length: 303 bp
ATGAATGAAGAGAGAAGGGAGGTTTCGGAAATCATGAGATACGCCATACCCATTGAAGTTGGGGGCATTCGGAGGAGGATAGTGGGGACTAGAGATGTGACAGAGAGAACGAAGAGGATGAAATTCAAGCATGCCAGGAGGAGACTTGGGAAGGAACAAGAGCTCCTAAAATTGGATTTCGGAGGAAGACATTTTCTAGGTTTTGAATTTGAATTGCTACAGAATCTGAAATGTGTTTTTGGTTTGAAAGTGAGATGTGTGTTTGATTTGAGTGGTCAAGGTTTGATCTTGGTTAGAAATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

100

Amino Acids

11.81

Weight (kDa)

10.4

Isoelectric Point (pI)

56.71

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0021663)

Species Orthologous Gene IDs
rosa_multiflora Rmu_sc0003880.1_g000044
rosa_samantha Rh5AG482300 Rh5CG030300 Rh5CG526400 Rh6AG318500

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 122, 206
AfiI CCNNNNNNNGG 1 cut(s) 172
AgsI TTSAA 5 cut(s) 56, 127, 206, 212, 247
AjnI CCWGG 1 cut(s) 134
AloI GAACNNNNNNTCC 2 cut(s) 147, 179
AluBI AGCT 1 cut(s) 163
AluI AGCT 1 cut(s) 163
Alw21I GWGCWC 1 cut(s) 165
Alw26I GTCTC 1 cut(s) 136
AlwNI CAGNNNCTG 1 cut(s) 226
ApoI RAATTY 2 cut(s) 122, 206
BanII GRGCYC 1 cut(s) 165
BbsI GAAGAC 1 cut(s) 193
Bbv12I GWGCWC 1 cut(s) 165
BciT130I CCWGG 1 cut(s) 136
BcoDI GTCTC 1 cut(s) 136
BfaI CTAG 2 cut(s) 90, 197
BfmI CTRYAG 1 cut(s) 218
Bme1390I CCNGG 1 cut(s) 136
BmrFI CCNGG 1 cut(s) 136
BpiI GAAGAC 1 cut(s) 193
BsaXI ACNNNNNCTCC 2 cut(s) 147, 177
Bsc4I CCNNNNNNNGG 1 cut(s) 172
BseBI CCWGG 1 cut(s) 136
BseGI GGATG 1 cut(s) 123
BseLI CCNNNNNNNGG 1 cut(s) 172
BseRI GAGGAG 2 cut(s) 88, 154
BsiHKAI GWGCWC 1 cut(s) 165
BslFI GGGAC 1 cut(s) 100
BslI CCNNNNNNNGG 1 cut(s) 172
BsmAI GTCTC 1 cut(s) 136
BsmFI GGGAC 1 cut(s) 100
BsmI GAATGC 1 cut(s) 66
Bsp1286I GDGCHC 1 cut(s) 165
Bsp143I GATC 1 cut(s) 285
BspHI TCATGA 1 cut(s) 33
BssMI GATC 1 cut(s) 285
Bst2UI CCWGG 1 cut(s) 136
Bst6I CTCTTC 2 cut(s) 3, 107
BstC8I GCNNGC 1 cut(s) 132
BstF5I GGATG 1 cut(s) 123
BstKTI GATC 1 cut(s) 288
BstMAI GTCTC 1 cut(s) 136
BstMBI GATC 1 cut(s) 285
BstNI CCWGG 1 cut(s) 136
BstNSI RCATGY 1 cut(s) 134
BstSCI CCNGG 1 cut(s) 134
BstSFI CTRYAG 1 cut(s) 218
BstV2I GAAGAC 1 cut(s) 193
BtsCI GGATG 1 cut(s) 123
Cac8I GCNNGC 1 cut(s) 132
CaiI CAGNNNCTG 1 cut(s) 226
CciI TCATGA 1 cut(s) 33
CviAII CATG 2 cut(s) 34, 131
CviJI RGCY 1 cut(s) 163
CviKI_1 RGCY 1 cut(s) 163
DpnI GATC 1 cut(s) 287
DpnII GATC 1 cut(s) 285
Eam1104I CTCTTC 2 cut(s) 3, 107
EarI CTCTTC 2 cut(s) 3, 107
Ecl136II GAGCTC 1 cut(s) 163
Eco24I GRGCYC 1 cut(s) 165
Eco53kI GAGCTC 1 cut(s) 163
EcoICRI GAGCTC 1 cut(s) 163
EcoRII CCWGG 1 cut(s) 134
EcoT38I GRGCYC 1 cut(s) 165
FaeI CATG 2 cut(s) 37, 134
FaiI YATR 3 cut(s) 35, 47, 132
FaqI GGGAC 1 cut(s) 100
FatI CATG 2 cut(s) 33, 130
FokI GGATG 1 cut(s) 130
FriOI GRGCYC 1 cut(s) 165
FspBI CTAG 2 cut(s) 90, 197
Hin1II CATG 2 cut(s) 37, 134
HinfI GANTC 1 cut(s) 223
Hpy188I TCNGA 4 cut(s) 28, 72, 182, 228
Hpy188III TCNNGA 1 cut(s) 34
HpyAV CCTTC 2 cut(s) 9, 145
Hsp92II CATG 2 cut(s) 37, 134
Kzo9I GATC 1 cut(s) 285
LmnI GCTCC 1 cut(s) 168
LpnPI CCDG 2 cut(s) 121, 148
MaeI CTAG 2 cut(s) 90, 197
MaeIII GTNAC 1 cut(s) 97
MalI GATC 1 cut(s) 287
MboI GATC 1 cut(s) 285
MboII GAAGA 3 cut(s) 20, 124, 198
MhlI GDGCHC 1 cut(s) 165
MluCI AATT 5 cut(s) 122, 170, 206, 212, 298
MnlI CCTC 6 cut(s) 13, 66, 69, 108, 132, 176
MseI TTAA 1 cut(s) 301
MspR9I CCNGG 1 cut(s) 136
Mva1269I GAATGC 1 cut(s) 66
MvaI CCWGG 1 cut(s) 136
NdeII GATC 1 cut(s) 285
NlaIII CATG 2 cut(s) 37, 134
NmuCI GTSAC 1 cut(s) 97
NspI RCATGY 1 cut(s) 134
PaeI GCATGC 1 cut(s) 134
PagI TCATGA 1 cut(s) 33
PctI GAATGC 1 cut(s) 66
PfeI GAWTC 1 cut(s) 223
Psp124BI GAGCTC 1 cut(s) 165
Psp6I CCWGG 1 cut(s) 134
PspGI CCWGG 1 cut(s) 134
PstNI CAGNNNCTG 1 cut(s) 226
SacI GAGCTC 1 cut(s) 165
SaqAI TTAA 1 cut(s) 301
Sau3AI GATC 1 cut(s) 285
ScrFI CCNGG 1 cut(s) 136
SduI GDGCHC 1 cut(s) 165
SetI ASST 4 cut(s) 24, 165, 202, 283
SfcI CTRYAG 1 cut(s) 218
SphI GCATGC 1 cut(s) 134
Sse9I AATT 5 cut(s) 122, 170, 206, 212, 298
SspMI CTAG 2 cut(s) 90, 197
SstI GAGCTC 1 cut(s) 165
StyD4I CCNGG 1 cut(s) 134
TasI AATT 5 cut(s) 122, 170, 206, 212, 298
TfiI GAWTC 1 cut(s) 223
Tru1I TTAA 1 cut(s) 301
Tru9I TTAA 1 cut(s) 301
TseFI GTSAC 1 cut(s) 97
Tsp45I GTSAC 1 cut(s) 97
TspDTI ATGAA 3 cut(s) 17, 21, 134
XapI RAATTY 2 cut(s) 122, 206
XceI RCATGY 1 cut(s) 134
XspI CTAG 2 cut(s) 90, 197
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.