Rh5BG075000

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5B
Physical Location & Seq
Forward (+)
6323293 .. 6323641
349 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5BG075000.1

Sequence Viewer

Length: 237 bp
ATGAGCTGCTGTTGCGGTGAGGATTGCCGGCCTTTGGGGTTTCTACTTGGCCTGCCCTTTGCTTTCGTTGCCCTCCTCCTCTCCGTTATTGGCGTGTTCATCTGGATTGTCGGGTTGGCGTTGACTTGCATATGCCCATGCTGCTTGTGTGCGACGATCATAGTAGAGCTTGCTTTGTCGTTGATCAAGGCTCCATTTTCGATCATGGAGTGGTTCACATCCAAGATTCCTTGTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

78

Amino Acids

8.4

Weight (kDa)

4.87

Isoelectric Point (pI)

28.8

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 15
AfiI CCNNNNNNNGG 1 cut(s) 34
AluBI AGCT 2 cut(s) 6, 169
AluI AGCT 2 cut(s) 6, 169
AoxI GGCC 2 cut(s) 29, 49
ApeKI GCWGC 2 cut(s) 6, 141
AsuHPI GGTGA 1 cut(s) 29
BbvI GCAGC 1 cut(s) 128
BclI TGATCA 1 cut(s) 183
BisI GCNGC 2 cut(s) 7, 142
BlsI GCNGC 2 cut(s) 8, 143
BmiI GGNNCC 1 cut(s) 192
Bsc4I CCNNNNNNNGG 1 cut(s) 34
Bse118I RCCGGY 1 cut(s) 27
BseGI GGATG 1 cut(s) 218
BseLI CCNNNNNNNGG 1 cut(s) 34
BseRI GAGGAG 2 cut(s) 65, 68
BseXI GCAGC 1 cut(s) 128
BshFI GGCC 2 cut(s) 31, 51
BsiSI CCGG 1 cut(s) 28
BslI CCNNNNNNNGG 1 cut(s) 34
BsnI GGCC 2 cut(s) 31, 51
Bsp143I GATC 3 cut(s) 156, 183, 201
BspACI CCGC 1 cut(s) 15
BspANI GGCC 2 cut(s) 31, 51
BspLI GGNNCC 1 cut(s) 192
BsrFI RCCGGY 1 cut(s) 27
BssAI RCCGGY 1 cut(s) 27
BssMI GATC 3 cut(s) 156, 183, 201
BstC8I GCNNGC 3 cut(s) 29, 53, 171
BstF5I GGATG 1 cut(s) 218
BstKTI GATC 3 cut(s) 159, 186, 204
BstMBI GATC 3 cut(s) 156, 183, 201
BstMWI GCNNNNNNNGC 3 cut(s) 12, 68, 141
BstV1I GCAGC 1 cut(s) 128
BsuRI GGCC 2 cut(s) 31, 51
BtsCI GGATG 1 cut(s) 218
Cac8I GCNNGC 3 cut(s) 29, 53, 171
Cfr10I RCCGGY 1 cut(s) 27
CviAII CATG 2 cut(s) 138, 205
CviJI RGCY 5 cut(s) 6, 31, 51, 169, 191
CviKI_1 RGCY 5 cut(s) 6, 31, 51, 169, 191
DpnI GATC 3 cut(s) 158, 185, 203
DpnII GATC 3 cut(s) 156, 183, 201
FaeI CATG 2 cut(s) 141, 208
FaiI YATR 5 cut(s) 131, 133, 139, 161, 206
FatI CATG 2 cut(s) 137, 204
FauNDI CATATG 1 cut(s) 131
FbaI TGATCA 1 cut(s) 183
Fnu4HI GCNGC 2 cut(s) 7, 142
FokI GGATG 1 cut(s) 205
Fsp4HI GCNGC 2 cut(s) 7, 142
GluI GCNGC 2 cut(s) 7, 142
HaeIII GGCC 2 cut(s) 31, 51
HapII CCGG 1 cut(s) 28
Hin1II CATG 2 cut(s) 141, 208
HincII GTYRAC 1 cut(s) 123
HindII GTYRAC 1 cut(s) 123
HinfI GANTC 1 cut(s) 226
HpaII CCGG 1 cut(s) 28
HphI GGTGA 1 cut(s) 29
Hpy166II GTNNAC 2 cut(s) 123, 216
Hpy188III TCNNGA 1 cut(s) 103
Hpy8I GTNNAC 2 cut(s) 123, 216
Hpy99I CGWCG 1 cut(s) 157
HpyCH4V TGCA 1 cut(s) 129
HpyF10VI GCNNNNNNNGC 3 cut(s) 12, 68, 141
Hsp92II CATG 2 cut(s) 141, 208
KroI GCCGGC 1 cut(s) 27
KroNI GCCGGC 1 cut(s) 29
Ksp22I TGATCA 1 cut(s) 183
Kzo9I GATC 3 cut(s) 156, 183, 201
LmnI GCTCC 1 cut(s) 196
LpnPI CCDG 3 cut(s) 41, 65, 88
Lsp1109I GCAGC 1 cut(s) 128
MalI GATC 3 cut(s) 158, 185, 203
MboI GATC 3 cut(s) 156, 183, 201
MnlI CCTC 4 cut(s) 13, 83, 86, 89
MroNI GCCGGC 1 cut(s) 27
MspI CCGG 1 cut(s) 28
MwoI GCNNNNNNNGC 3 cut(s) 12, 68, 141
NaeI GCCGGC 1 cut(s) 29
NdeI CATATG 1 cut(s) 131
NdeII GATC 3 cut(s) 156, 183, 201
NgoMIV GCCGGC 1 cut(s) 27
NlaIII CATG 2 cut(s) 141, 208
NlaIV GGNNCC 1 cut(s) 192
PdiI GCCGGC 1 cut(s) 29
PfeI GAWTC 1 cut(s) 226
PkrI GCNGC 2 cut(s) 8, 143
PspN4I GGNNCC 1 cut(s) 192
SatI GCNGC 2 cut(s) 7, 142
Sau3AI GATC 3 cut(s) 156, 183, 201
SetI ASST 2 cut(s) 8, 171
SsiI CCGC 1 cut(s) 15
TaqI TCGA 1 cut(s) 200
TfiI GAWTC 1 cut(s) 226
TseI GCWGC 2 cut(s) 6, 141
TspDTI ATGAA 1 cut(s) 88
TspGWI ACGGA 1 cut(s) 73
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.