Rh5BG501400

histone H2B.1

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5B
OG0021857
Physical Location & Seq
Reverse (-)
79777453 .. 79781783
4331 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5BG501400.1

Sequence Viewer

Length: 180 bp
ATGAACAAATTCATCAACGACATCTTCGAGAAGCTCGCTCAGGAGTCGTCGAGGCTCGCCAGGTACAACAAGAAGCCGACAATTACTTCCCGGGACATCCAGACGGCGGTGAGGCTTGTGCTTCCCGGTGGCCGTGCCCAAATGGGTACAAACGAGGTCCTTTCATCAGCTATTGTTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko05034 ko05203 ko05322 map05034 map05203 map05322
Pfam Domains
Protein Families
Histone

Protein Analysis

59

Amino Acids

6.58

Weight (kDa)

10.15

Isoelectric Point (pI)

33.38

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Histone PF00125 1 - 39 5.7e-10 Core histone H2A/H2B/H3/H4 domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0021857)

Species Orthologous Gene IDs
arabidopsis_thaliana AT5G02570
prunus_persica Prupe.1G169000_v2.0.a1
rosa_samantha Rh5BG501400
rosa_wichuraiana Rw5G044660

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 107
AcoI YGGCCR 1 cut(s) 130
AcsI RAATTY 1 cut(s) 8
AfaI GTAC 2 cut(s) 65, 148
AfiI CCNNNNNNNGG 1 cut(s) 106
AjnI CCWGG 1 cut(s) 59
AluBI AGCT 2 cut(s) 34, 170
AluI AGCT 2 cut(s) 34, 170
Ama87I CYCGRG 1 cut(s) 90
AoxI GGCC 1 cut(s) 130
ApoI RAATTY 1 cut(s) 8
Asp700I GAANNNNTTC 1 cut(s) 8
AspS9I GGNCC 1 cut(s) 157
AsuC2I CCSGG 3 cut(s) 91, 92, 126
AsuHPI GGTGA 1 cut(s) 121
AvaI CYCGRG 1 cut(s) 90
AvaII GGWCC 1 cut(s) 157
BaeGI GKGCMC 1 cut(s) 139
BceAI ACGGC 2 cut(s) 117, 120
BciT130I CCWGG 1 cut(s) 61
BcnI CCSGG 3 cut(s) 91, 92, 126
Bme1390I CCNGG 4 cut(s) 61, 91, 92, 126
Bme18I GGWCC 1 cut(s) 157
BmeT110I CYCGRG 1 cut(s) 90
BmgT120I GGNCC 1 cut(s) 157
BmrFI CCNGG 4 cut(s) 61, 91, 92, 126
Bpu10I CCTNAGC 1 cut(s) 39
BpuMI CCSGG 3 cut(s) 91, 92, 126
BsaJI CCNNGG 1 cut(s) 90
Bsc4I CCNNNNNNNGG 1 cut(s) 106
BseBI CCWGG 1 cut(s) 61
BseDI CCNNGG 1 cut(s) 90
BseGI GGATG 1 cut(s) 96
BseLI CCNNNNNNNGG 1 cut(s) 106
BseMII CTCAG 1 cut(s) 53
BseSI GKGCMC 1 cut(s) 139
BshFI GGCC 1 cut(s) 132
BsiHKCI CYCGRG 1 cut(s) 90
BsiSI CCGG 2 cut(s) 91, 126
BslFI GGGAC 1 cut(s) 107
BslI CCNNNNNNNGG 1 cut(s) 106
BsmFI GGGAC 1 cut(s) 107
BsnI GGCC 1 cut(s) 132
BsoBI CYCGRG 1 cut(s) 90
Bsp1286I GDGCHC 1 cut(s) 139
BspACI CCGC 1 cut(s) 107
BspANI GGCC 1 cut(s) 132
BspCNI CTCAG 1 cut(s) 52
BssECI CCNNGG 1 cut(s) 90
Bst2UI CCWGG 1 cut(s) 61
BstC8I GCNNGC 2 cut(s) 36, 57
BstDEI CTNAG 1 cut(s) 39
BstF5I GGATG 1 cut(s) 96
BstNI CCWGG 1 cut(s) 61
BstSCI CCNGG 4 cut(s) 59, 89, 90, 124
BstSLI GKGCMC 1 cut(s) 139
BsuRI GGCC 1 cut(s) 132
BtsCI GGATG 1 cut(s) 96
Cac8I GCNNGC 2 cut(s) 36, 57
Cfr13I GGNCC 1 cut(s) 157
Cfr9I CCCGGG 1 cut(s) 90
Csp6I GTAC 2 cut(s) 64, 147
CviJI RGCY 6 cut(s) 34, 55, 76, 115, 132, 170
CviKI_1 RGCY 6 cut(s) 34, 55, 76, 115, 132, 170
CviQI GTAC 2 cut(s) 64, 147
DdeI CTNAG 1 cut(s) 39
EaeI YGGCCR 1 cut(s) 130
Eco47I GGWCC 1 cut(s) 157
Eco88I CYCGRG 1 cut(s) 90
EcoO109I RGGNCCY 1 cut(s) 157
EcoRII CCWGG 1 cut(s) 59
FaqI GGGAC 1 cut(s) 107
FokI GGATG 1 cut(s) 83
HaeIII GGCC 1 cut(s) 132
HapII CCGG 2 cut(s) 91, 126
HinfI GANTC 1 cut(s) 44
HpaII CCGG 2 cut(s) 91, 126
HphI GGTGA 1 cut(s) 121
Hpy188III TCNNGA 3 cut(s) 28, 41, 100
Hpy99I CGWCG 1 cut(s) 52
HpyF3I CTNAG 1 cut(s) 39
LpnPI CCDG 6 cut(s) 26, 46, 73, 104, 113, 139
MboII GAAGA 1 cut(s) 16
MhlI GDGCHC 1 cut(s) 139
MluCI AATT 2 cut(s) 8, 81
MlyI GAGTC 1 cut(s) 53
MnlI CCTC 3 cut(s) 45, 105, 148
MroXI GAANNNNTTC 1 cut(s) 8
MseI TTAA 1 cut(s) 178
MspI CCGG 2 cut(s) 91, 126
MspR9I CCNGG 4 cut(s) 61, 91, 92, 126
MvaI CCWGG 1 cut(s) 61
NciI CCSGG 3 cut(s) 91, 92, 126
PcsI WCGNNNNNNNCGW 1 cut(s) 24
PdmI GAANNNNTTC 1 cut(s) 8
PleI GAGTC 1 cut(s) 52
PpsI GAGTC 1 cut(s) 52
PpuMI RGGWCCY 1 cut(s) 157
Psp5II RGGWCCY 1 cut(s) 157
Psp6I CCWGG 1 cut(s) 59
PspGI CCWGG 1 cut(s) 59
PspPI GGNCC 1 cut(s) 157
PspPPI RGGWCCY 1 cut(s) 157
RsaI GTAC 2 cut(s) 65, 148
RsaNI GTAC 2 cut(s) 64, 147
SaqAI TTAA 1 cut(s) 178
Sau96I GGNCC 1 cut(s) 157
SchI GAGTC 1 cut(s) 53
ScrFI CCNGG 4 cut(s) 61, 91, 92, 126
SduI GDGCHC 1 cut(s) 139
SetI ASST 4 cut(s) 36, 65, 159, 172
SinI GGWCC 1 cut(s) 157
SmaI CCCGGG 1 cut(s) 92
Sse9I AATT 2 cut(s) 8, 81
SsiI CCGC 1 cut(s) 107
StyD4I CCNGG 4 cut(s) 59, 89, 90, 124
TaqI TCGA 2 cut(s) 27, 50
TasI AATT 2 cut(s) 8, 81
Tru1I TTAA 1 cut(s) 178
Tru9I TTAA 1 cut(s) 178
TspDTI ATGAA 2 cut(s) 17, 153
TspMI CCCGGG 1 cut(s) 90
VpaK11BI GGWCC 1 cut(s) 157
XapI RAATTY 1 cut(s) 8
XmaI CCCGGG 1 cut(s) 90
XmnI GAANNNNTTC 1 cut(s) 8
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.