Rh5BG526300

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5B
OG0020440
Physical Location & Seq
Reverse (-)
82943616 .. 82944673
1058 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5BG526300.1

Sequence Viewer

Length: 300 bp
ATGTTGAAAAACATGCATGACAGAGTTATCGTTAGTTTGTTCAATGCACCAGGAATGAGAACCCGCGCGATGGCACGGGGTTCTCTGTTTCTACAGATATTTTCTGAACACATTTCGTACAACAACCTCGAAGCTCATTTGTGTATTGATCTGAAAGGCCGTCAACTTTGTGCTTTAAAGAGTGGCAATTGCTTCCCTCCAGCCATGGAGTATGCAAGAGTTGTTGAACACCTCAAGATTATATATCATGTTTCCCTTCTCGACTTCCTCAGTCATCCAAGAACCCCGCACCACTGCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

99

Amino Acids

11.37

Weight (kDa)

9.1

Isoelectric Point (pI)

26.25

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0020440)

Species Orthologous Gene IDs
pyrus_communis pycom08g19250
rosa_laevigata RLG00000001953
rosa_roxburghii Rroxscaffold_3G00235430
rosa_samantha Rh5BG526300 Rh7AG372600 Rh7CG390900

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 2 cut(s) 66, 68
AciI CCGC 2 cut(s) 64, 287
AfaI GTAC 1 cut(s) 119
AfiI CCNNNNNNNGG 1 cut(s) 70
AgsI TTSAA 3 cut(s) 7, 43, 227
AjnI CCWGG 1 cut(s) 49
AluBI AGCT 1 cut(s) 134
AluI AGCT 1 cut(s) 134
AoxI GGCC 1 cut(s) 157
AspLEI GCGC 1 cut(s) 68
BccI CCATC 1 cut(s) 64
BceAI ACGGC 1 cut(s) 144
BciT130I CCWGG 1 cut(s) 51
BfmI CTRYAG 1 cut(s) 92
Bme1390I CCNGG 1 cut(s) 51
BmrFI CCNGG 1 cut(s) 51
BpmI CTGGAG 1 cut(s) 183
BpuEI CTTGAG 1 cut(s) 218
BsaJI CCNNGG 1 cut(s) 204
Bsc4I CCNNNNNNNGG 1 cut(s) 70
BseBI CCWGG 1 cut(s) 51
BseDI CCNNGG 1 cut(s) 204
BseGI GGATG 1 cut(s) 274
BseLI CCNNNNNNNGG 1 cut(s) 70
BseMII CTCAG 1 cut(s) 283
Bsh1236I CGCG 2 cut(s) 66, 68
BshFI GGCC 1 cut(s) 159
BslI CCNNNNNNNGG 1 cut(s) 70
BsnI GGCC 1 cut(s) 159
Bsp143I GATC 1 cut(s) 148
Bsp19I CCATGG 1 cut(s) 204
BspACI CCGC 2 cut(s) 64, 287
BspANI GGCC 1 cut(s) 159
BspCNI CTCAG 1 cut(s) 282
BspFNI CGCG 2 cut(s) 66, 68
BssECI CCNNGG 1 cut(s) 204
BssMI GATC 1 cut(s) 148
BssT1I CCWWGG 1 cut(s) 204
Bst2UI CCWGG 1 cut(s) 51
BstDEI CTNAG 1 cut(s) 269
BstDSI CCRYGG 1 cut(s) 204
BstF5I GGATG 1 cut(s) 274
BstFNI CGCG 2 cut(s) 66, 68
BstHHI GCGC 1 cut(s) 68
BstKTI GATC 1 cut(s) 151
BstMBI GATC 1 cut(s) 148
BstNI CCWGG 1 cut(s) 51
BstNSI RCATGY 1 cut(s) 16
BstSCI CCNGG 1 cut(s) 49
BstSFI CTRYAG 1 cut(s) 92
BstUI CGCG 2 cut(s) 66, 68
BsuRI GGCC 1 cut(s) 159
BtgI CCRYGG 1 cut(s) 204
BtgZI GCGATG 1 cut(s) 83
BtsCI GGATG 1 cut(s) 274
BtsI GCAGTG 1 cut(s) 292
BtsIMutI CAGTG 1 cut(s) 292
CfoI GCGC 1 cut(s) 68
Csp6I GTAC 1 cut(s) 118
CviAII CATG 4 cut(s) 13, 17, 205, 248
CviJI RGCY 3 cut(s) 134, 159, 203
CviKI_1 RGCY 3 cut(s) 134, 159, 203
CviQI GTAC 1 cut(s) 118
DdeI CTNAG 1 cut(s) 269
DpnI GATC 1 cut(s) 150
DpnII GATC 1 cut(s) 148
DraI TTTAAA 1 cut(s) 177
Eco130I CCWWGG 1 cut(s) 204
EcoRII CCWGG 1 cut(s) 49
EcoT14I CCWWGG 1 cut(s) 204
EcoT22I ATGCAT 1 cut(s) 18
ErhI CCWWGG 1 cut(s) 204
FaeI CATG 4 cut(s) 16, 20, 208, 251
FaiI YATR 7 cut(s) 14, 18, 206, 213, 242, 244, 249
FatI CATG 4 cut(s) 12, 16, 204, 247
FauI CCCGC 2 cut(s) 71, 294
FokI GGATG 1 cut(s) 261
GlaI GCGC 1 cut(s) 67
GsuI CTGGAG 1 cut(s) 183
HaeIII GGCC 1 cut(s) 159
HhaI GCGC 1 cut(s) 68
Hin1II CATG 4 cut(s) 16, 20, 208, 251
Hin6I GCGC 1 cut(s) 66
HinP1I GCGC 1 cut(s) 66
HincII GTYRAC 1 cut(s) 164
HindII GTYRAC 1 cut(s) 164
Hpy166II GTNNAC 1 cut(s) 164
Hpy188I TCNGA 2 cut(s) 106, 153
Hpy188III TCNNGA 2 cut(s) 235, 260
Hpy8I GTNNAC 1 cut(s) 164
HpyAV CCTTC 1 cut(s) 266
HpyCH4V TGCA 3 cut(s) 16, 47, 215
HpyF3I CTNAG 1 cut(s) 269
Hsp92II CATG 4 cut(s) 16, 20, 208, 251
HspAI GCGC 1 cut(s) 66
Kzo9I GATC 1 cut(s) 148
LpnPI CCDG 3 cut(s) 36, 63, 213
MalI GATC 1 cut(s) 150
MboI GATC 1 cut(s) 148
MfeI CAATTG 1 cut(s) 187
MluCI AATT 1 cut(s) 187
MnlI CCTC 4 cut(s) 137, 207, 242, 278
Mph1103I ATGCAT 1 cut(s) 18
MseI TTAA 1 cut(s) 176
MspR9I CCNGG 1 cut(s) 51
MunI CAATTG 1 cut(s) 187
MvaI CCWGG 1 cut(s) 51
MvnI CGCG 2 cut(s) 66, 68
NcoI CCATGG 1 cut(s) 204
NdeII GATC 1 cut(s) 148
NlaIII CATG 4 cut(s) 16, 20, 208, 251
NsiI ATGCAT 1 cut(s) 18
NspI RCATGY 1 cut(s) 16
Psp6I CCWGG 1 cut(s) 49
PspGI CCWGG 1 cut(s) 49
RsaI GTAC 1 cut(s) 119
RsaNI GTAC 1 cut(s) 118
SaqAI TTAA 1 cut(s) 176
Sau3AI GATC 1 cut(s) 148
ScrFI CCNGG 1 cut(s) 51
SetI ASST 3 cut(s) 129, 136, 234
SfcI CTRYAG 1 cut(s) 92
SmlI CTYRAG 1 cut(s) 233
SmoI CTYRAG 1 cut(s) 233
Sse9I AATT 1 cut(s) 187
SsiI CCGC 2 cut(s) 64, 287
StyD4I CCNGG 1 cut(s) 49
StyI CCWWGG 1 cut(s) 204
TaqI TCGA 2 cut(s) 129, 261
TasI AATT 1 cut(s) 187
Tru1I TTAA 1 cut(s) 176
Tru9I TTAA 1 cut(s) 176
TscAI CASTG 1 cut(s) 299
TspRI CASTG 1 cut(s) 299
XceI RCATGY 1 cut(s) 16
Zsp2I ATGCAT 1 cut(s) 18
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.