Rh5CG298800

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5C
Physical Location & Seq
Forward (+)
32903454 .. 32904005
552 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5CG298800.1

Sequence Viewer

Length: 249 bp
ATGGTCGCAGTCGCTGGATCATGTACGACAGCCAGCACTATTAAAAGTTTAAAATCTGGTCAAGAAGCAAGACCAACACCATTAGAATCTGAACCAGTTGCGTTGCAAGTGGATGAGAATAGGGGACTCCAACAATTTGAGGCTGATCAAGAAGCGGCTGAACTAGAAAAGTGGATTGAAGCTGAATTTGAAGCTCAACCTCAACTAGGAGAAGAAAATCTTGAGCAGTACGTGAAGGTGATGATGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

82

Amino Acids

9.05

Weight (kDa)

4.2

Isoelectric Point (pI)

49.56

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0023000)

Species Orthologous Gene IDs
rosa_laevigata RLG00000033868
rosa_roxburghii Rroxscaffold_1G00042280
rosa_samantha Rh5AG261600 Rh5CG298800

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 155
AclWI GGATC 1 cut(s) 25
AcsI RAATTY 1 cut(s) 185
AfaI GTAC 2 cut(s) 25, 230
AfiI CCNNNNNNNGG 1 cut(s) 206
AgsI TTSAA 2 cut(s) 179, 191
AluBI AGCT 2 cut(s) 182, 194
AluI AGCT 2 cut(s) 182, 194
AlwI GGATC 1 cut(s) 25
AlwNI CAGNNNCTG 1 cut(s) 14
ApoI RAATTY 1 cut(s) 185
BclI TGATCA 1 cut(s) 145
BfaI CTAG 2 cut(s) 164, 206
BisI GCNGC 1 cut(s) 156
BlsI GCNGC 1 cut(s) 157
BpuEI CTTGAG 1 cut(s) 242
BsaAI YACGTR 1 cut(s) 232
Bsc4I CCNNNNNNNGG 1 cut(s) 206
Bse1I ACTGG 1 cut(s) 95
BseGI GGATG 1 cut(s) 118
BseLI CCNNNNNNNGG 1 cut(s) 206
BseNI ACTGG 1 cut(s) 95
BslFI GGGAC 1 cut(s) 138
BslI CCNNNNNNNGG 1 cut(s) 206
BsmFI GGGAC 1 cut(s) 138
Bsp143I GATC 2 cut(s) 17, 145
BspACI CCGC 1 cut(s) 155
BspPI GGATC 1 cut(s) 25
BsrI ACTGG 1 cut(s) 95
BssMI GATC 2 cut(s) 17, 145
BstBAI YACGTR 1 cut(s) 232
BstC8I GCNNGC 1 cut(s) 34
BstENI CCTNNNNNAGG 1 cut(s) 204
BstF5I GGATG 1 cut(s) 118
BstKTI GATC 2 cut(s) 20, 148
BstMBI GATC 2 cut(s) 17, 145
BtsCI GGATG 1 cut(s) 118
Cac8I GCNNGC 1 cut(s) 34
CaiI CAGNNNCTG 1 cut(s) 14
Csp6I GTAC 2 cut(s) 24, 229
CviAII CATG 1 cut(s) 21
CviJI RGCY 5 cut(s) 32, 143, 158, 182, 194
CviKI_1 RGCY 5 cut(s) 32, 143, 158, 182, 194
CviQI GTAC 2 cut(s) 24, 229
DpnI GATC 2 cut(s) 19, 147
DpnII GATC 2 cut(s) 17, 145
DraI TTTAAA 1 cut(s) 51
EcoNI CCTNNNNNAGG 1 cut(s) 204
FaeI CATG 1 cut(s) 24
FaiI YATR 1 cut(s) 22
FalI AAGNNNNNCTT 2 cut(s) 204, 236
FaqI GGGAC 1 cut(s) 138
FatI CATG 1 cut(s) 20
FbaI TGATCA 1 cut(s) 145
Fnu4HI GCNGC 1 cut(s) 156
FokI GGATG 1 cut(s) 125
Fsp4HI GCNGC 1 cut(s) 156
FspBI CTAG 2 cut(s) 164, 206
GluI GCNGC 1 cut(s) 156
Hin1II CATG 1 cut(s) 24
HinfI GANTC 2 cut(s) 86, 126
Hpy188I TCNGA 1 cut(s) 91
Hpy188III TCNNGA 3 cut(s) 62, 149, 221
HpyAV CCTTC 1 cut(s) 229
HpyCH4IV ACGT 1 cut(s) 231
HpyCH4V TGCA 1 cut(s) 106
HpySE526I ACGT 1 cut(s) 231
Hsp92II CATG 1 cut(s) 24
Ksp22I TGATCA 1 cut(s) 145
Kzo9I GATC 2 cut(s) 17, 145
LpnPI CCDG 3 cut(s) 42, 46, 108
MaeI CTAG 2 cut(s) 164, 206
MaeII ACGT 1 cut(s) 231
MalI GATC 2 cut(s) 19, 147
MboI GATC 2 cut(s) 17, 145
MboII GAAGA 1 cut(s) 224
MluCI AATT 2 cut(s) 134, 185
MlyI GAGTC 1 cut(s) 120
MmeI TCCRAC 1 cut(s) 154
MnlI CCTC 2 cut(s) 133, 210
MseI TTAA 2 cut(s) 42, 50
NdeII GATC 2 cut(s) 17, 145
NlaIII CATG 1 cut(s) 24
PfeI GAWTC 1 cut(s) 86
PkrI GCNGC 1 cut(s) 157
PleI GAGTC 1 cut(s) 120
PpsI GAGTC 1 cut(s) 120
Ppu21I YACGTR 1 cut(s) 232
PstNI CAGNNNCTG 1 cut(s) 14
RsaI GTAC 2 cut(s) 25, 230
RsaNI GTAC 2 cut(s) 24, 229
SaqAI TTAA 2 cut(s) 42, 50
SatI GCNGC 1 cut(s) 156
Sau3AI GATC 2 cut(s) 17, 145
SchI GAGTC 1 cut(s) 120
SetI ASST 5 cut(s) 184, 196, 202, 234, 240
SmlI CTYRAG 1 cut(s) 221
SmoI CTYRAG 1 cut(s) 221
Sse9I AATT 2 cut(s) 134, 185
SsiI CCGC 1 cut(s) 155
SspMI CTAG 2 cut(s) 164, 206
TaiI ACGT 1 cut(s) 234
TasI AATT 2 cut(s) 134, 185
TauI GCSGC 1 cut(s) 158
TfiI GAWTC 1 cut(s) 86
Tru1I TTAA 2 cut(s) 42, 50
Tru9I TTAA 2 cut(s) 42, 50
XagI CCTNNNNNAGG 1 cut(s) 204
XapI RAATTY 1 cut(s) 185
XspI CTAG 2 cut(s) 164, 206
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.