Rh7AG041900

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7A
Physical Location & Seq
Forward (+)
2794742 .. 2802203
7462 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7AG041900.1

Sequence Viewer

Length: 189 bp
ATGGAGAGGAGATGGGTTCTGGGGACAGAGAGGTGTGCGGATAGTGGCGGCTATGCTGGTGCTAAGTCGAGATTTCCAAATAGAGAAAGGGTGAAGTTTCAGTTCCCATTCAAAGAGGCAAGGATCAGAACCATAGAATGCAAAACTGGGACTGCAGCTCAGTCATCTTTGAAAATCCATATCTCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

62

Amino Acids

7.08

Weight (kDa)

10.28

Isoelectric Point (pI)

69.78

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0022643)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr2g0167151
rosa_multiflora Rmu_co7972092.1_g000001
rosa_samantha Rh2BG606900 Rh7AG041900

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 38, 48
AclWI GGATC 1 cut(s) 131
AgsI TTSAA 2 cut(s) 112, 172
AluBI AGCT 1 cut(s) 158
AluI AGCT 1 cut(s) 158
AlwI GGATC 1 cut(s) 131
ApeKI GCWGC 1 cut(s) 155
AsuHPI GGTGA 1 cut(s) 103
BbvI GCAGC 1 cut(s) 167
BccI CCATC 1 cut(s) 6
BfmI CTRYAG 1 cut(s) 153
BisI GCNGC 2 cut(s) 49, 156
BlsI GCNGC 2 cut(s) 50, 157
BmrI ACTGGG 1 cut(s) 156
BmuI ACTGGG 1 cut(s) 156
Bse1I ACTGG 1 cut(s) 151
BseMII CTCAG 1 cut(s) 173
BseNI ACTGG 1 cut(s) 151
BseRI GAGGAG 1 cut(s) 22
BseXI GCAGC 1 cut(s) 167
BslFI GGGAC 2 cut(s) 37, 163
BsmFI GGGAC 2 cut(s) 37, 163
BsmI GAATGC 1 cut(s) 143
Bsp143I GATC 1 cut(s) 123
BspACI CCGC 2 cut(s) 38, 48
BspCNI CTCAG 1 cut(s) 172
BspMAI CTGCAG 1 cut(s) 157
BspPI GGATC 1 cut(s) 131
BsrI ACTGG 1 cut(s) 151
BssMI GATC 1 cut(s) 123
BstDEI CTNAG 2 cut(s) 63, 159
BstKTI GATC 1 cut(s) 126
BstMBI GATC 1 cut(s) 123
BstSFI CTRYAG 1 cut(s) 153
BstV1I GCAGC 1 cut(s) 167
CviJI RGCY 2 cut(s) 51, 158
CviKI_1 RGCY 2 cut(s) 51, 158
DdeI CTNAG 2 cut(s) 63, 159
DpnI GATC 1 cut(s) 125
DpnII GATC 1 cut(s) 123
FaiI YATR 3 cut(s) 54, 134, 180
FaqI GGGAC 2 cut(s) 37, 163
Fnu4HI GCNGC 2 cut(s) 49, 156
Fsp4HI GCNGC 2 cut(s) 49, 156
GluI GCNGC 2 cut(s) 49, 156
HphI GGTGA 1 cut(s) 103
Hpy188I TCNGA 1 cut(s) 128
Hpy188III TCNNGA 2 cut(s) 69, 186
HpyCH4V TGCA 2 cut(s) 141, 155
HpyF3I CTNAG 2 cut(s) 63, 159
Kzo9I GATC 1 cut(s) 123
LpnPI CCDG 3 cut(s) 5, 42, 132
Lsp1109I GCAGC 1 cut(s) 167
MalI GATC 1 cut(s) 125
MboI GATC 1 cut(s) 123
MnlI CCTC 2 cut(s) 24, 109
Mva1269I GAATGC 1 cut(s) 143
NdeII GATC 1 cut(s) 123
PctI GAATGC 1 cut(s) 143
PkrI GCNGC 2 cut(s) 50, 157
PstI CTGCAG 1 cut(s) 157
SatI GCNGC 2 cut(s) 49, 156
Sau3AI GATC 1 cut(s) 123
SetI ASST 2 cut(s) 35, 160
SfcI CTRYAG 1 cut(s) 153
SgeI CNNG 5 cut(s) 32, 69, 81, 132, 159
SsiI CCGC 2 cut(s) 38, 48
TaqI TCGA 1 cut(s) 68
TauI GCSGC 1 cut(s) 51
TseI GCWGC 1 cut(s) 155
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.