Basic Information

Type: gene

Biological Identity

Species

rosa_samantha

Chromosome

Chr7B

Orthogroup ID

OG0022772

Physical Location & Seq

Genomic Coordinates Forward (+)

40560419 .. 40561156

Gene Structure 738 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rh7BG377100.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 738 bp

ATGGCCAAACATTCAGCTAATAGATCTTGCAATATTTTCACATGTACAACTGAATGTTGGGTACGTATATTATCTTTAAAAAAGGATGGATCACATGAGAAGCTAAGTAAATGGAATGTGAATTGTCCAGGTCATCCCCATTGTTGCCAAATGGATGTAACCGAATATTATTTTGTATTTGGAGGGTCGCCTGATGCACTGAGTGTATGGAAGGTTGAAAAGTGCATCTGTGCTAGAGAAACATTTTTCACATGTGCAACATTCATGGAAGATAATGAAATTACACTTGTTGTGGGCAACAATATGCATGAGGTTATTGTCTATGATAGTAGAAGTTGGATGGTAAAACCTGAATTAAAAGTCACATTCTTAGAGGAGGAGACTCTTGAATACTGGGTCCTTATTACAACTATCACAAAAGATTTAAGTGGCACAAAATTCTACATAGGGAATGATTCTAGTGACCTTGCTTCGGTTGATATTAATTCAGGGAAAGTGATCAAATGCTTTGAGAATTTGAAAAGATGGCCTTGCAAGGACTCTCAAACTAGAAAAGTATCTAAATCTCCCATCCAAAAGAATCCAATTAAATTCATTGCAAGGGATGCACAACATCATCTAATAGCATCATCGGGCTTAGATCGCCATCTATGCTTTTGGAATAAAGATAATGGGAAGCTGCTCTCCACGATTTATCCTATACAAGATCTCACAAATGTAATTATTGATTCCCGTTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0005730 GO:0008150 GO:0022613 GO:0030684 GO:0030687 GO:0031974 GO:0031981 GO:0032991 GO:0042254 GO:0042273 GO:0043226 GO:0043227 GO:0043228 GO:0043229 GO:0043231 GO:0043232 GO:0043233 GO:0044085 GO:0044422 GO:0044424 GO:0044428 GO:0044446 GO:0044464 GO:0070013 GO:0071840 GO:1990904

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

245

Amino Acids

28.07

Weight (kDa)

7.52

Isoelectric Point (pI)

43.65

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0022772)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr5g0041021
rosa_laevigata	RLG00000031017
rosa_samantha	Rh5AG274800 Rh7BG377100

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AclWI	GGATC	1 cut(s)	97
AcoI	YGGCCR	1 cut(s)	3
AcsI	RAATTY	3 cut(s)	437, 514, 590
AdeI	CACNNNGTG	1 cut(s)	203
AfaI	GTAC	2 cut(s)	46, 63
AfiI	CCNNNNNNNGG	1 cut(s)	472
AflIII	ACRYGT	2 cut(s)	41, 251
AgsI	TTSAA	3 cut(s)	218, 389, 520
AjnI	CCWGG	1 cut(s)	127
AluBI	AGCT	3 cut(s)	17, 103, 679
AluI	AGCT	3 cut(s)	17, 103, 679
Alw26I	GTCTC	1 cut(s)	374
AlwI	GGATC	1 cut(s)	97
AoxI	GGCC	2 cut(s)	3, 527
ApeKI	GCWGC	1 cut(s)	679
ApoI	RAATTY	3 cut(s)	437, 514, 590
AseI	ATTAAT	1 cut(s)	483
AspS9I	GGNCC	1 cut(s)	397
AvaII	GGWCC	1 cut(s)	397
BalI	TGGCCA	1 cut(s)	5
BbvI	GCAGC	1 cut(s)	666
BccI	CCATC	5 cut(s)	80, 334, 519, 578, 654
BciT130I	CCWGG	1 cut(s)	129
BclI	TGATCA	1 cut(s)	498
BcoDI	GTCTC	1 cut(s)	374
BfaI	CTAG	3 cut(s)	234, 459, 549
BglII	AGATCT	2 cut(s)	23, 706
BisI	GCNGC	1 cut(s)	680
BlsI	GCNGC	1 cut(s)	681
Bme1390I	CCNGG	1 cut(s)	129
Bme18I	GGWCC	1 cut(s)	397
BmgT120I	GGNCC	1 cut(s)	397
BmiI	GGNNCC	1 cut(s)	398
BmrFI	CCNGG	1 cut(s)	129
BmrI	ACTGGG	1 cut(s)	403
BmsI	GCATC	4 cut(s)	184, 234, 595, 635
BmuI	ACTGGG	1 cut(s)	403
BsaAI	YACGTR	1 cut(s)	65
BsaBI	GATNNNNATC	1 cut(s)	645
Bsc4I	CCNNNNNNNGG	1 cut(s)	472
Bse1I	ACTGG	1 cut(s)	398
Bse3DI	GCAATG	1 cut(s)	594
Bse8I	GATNNNNATC	1 cut(s)	645
BseBI	CCWGG	1 cut(s)	129
BseGI	GGATG	6 cut(s)	91, 133, 160, 345, 570, 610
BseJI	GATNNNNATC	1 cut(s)	645
BseLI	CCNNNNNNNGG	1 cut(s)	472
BseMI	GCAATG	1 cut(s)	594
BseMII	CTCAG	1 cut(s)	191
BseNI	ACTGG	1 cut(s)	398
BseRI	GAGGAG	2 cut(s)	389, 392
BseXI	GCAGC	1 cut(s)	666
BshFI	GGCC	2 cut(s)	5, 529
BslI	CCNNNNNNNGG	1 cut(s)	472
BsmAI	GTCTC	1 cut(s)	374
BsnI	GGCC	2 cut(s)	5, 529
Bsp1407I	TGTACA	1 cut(s)	44
Bsp143I	GATC	5 cut(s)	23, 89, 498, 640, 706
BspANI	GGCC	2 cut(s)	5, 529
BspCNI	CTCAG	1 cut(s)	192
BspLI	GGNNCC	1 cut(s)	398
BspPI	GGATC	1 cut(s)	97
BsrDI	GCAATG	1 cut(s)	594
BsrGI	TGTACA	1 cut(s)	44
BsrI	ACTGG	1 cut(s)	398
BssMI	GATC	5 cut(s)	23, 89, 498, 640, 706
Bst2UI	CCWGG	1 cut(s)	129
BstAPI	GCANNNNNTGC	1 cut(s)	605
BstAUI	TGTACA	1 cut(s)	44
BstBAI	YACGTR	1 cut(s)	65
BstDEI	CTNAG	4 cut(s)	104, 200, 370, 637
BstF5I	GGATG	6 cut(s)	91, 133, 160, 345, 570, 610
BstKTI	GATC	5 cut(s)	26, 92, 501, 643, 709
BstMAI	GTCTC	1 cut(s)	374
BstMBI	GATC	5 cut(s)	23, 89, 498, 640, 706
BstMWI	GCNNNNNNNGC	3 cut(s)	605, 642, 651
BstNI	CCWGG	1 cut(s)	129
BstNSI	RCATGY	2 cut(s)	45, 255
BstSCI	CCNGG	1 cut(s)	127
BstSNI	TACGTA	1 cut(s)	65
BstV1I	GCAGC	1 cut(s)	666
BstX2I	RGATCY	2 cut(s)	23, 706
BstYI	RGATCY	2 cut(s)	23, 706
BsuRI	GGCC	2 cut(s)	5, 529
BtsCI	GGATG	6 cut(s)	91, 133, 160, 345, 570, 610
BtsIMutI	CAGTG	1 cut(s)	197
Cfr13I	GGNCC	1 cut(s)	397
Csp6I	GTAC	2 cut(s)	45, 62
CviAII	CATG	5 cut(s)	42, 95, 252, 265, 308
CviJI	RGCY	6 cut(s)	5, 17, 103, 529, 636, 679
CviKI_1	RGCY	6 cut(s)	5, 17, 103, 529, 636, 679
CviQI	GTAC	2 cut(s)	45, 62
DdeI	CTNAG	4 cut(s)	104, 200, 370, 637
DpnI	GATC	5 cut(s)	25, 91, 500, 642, 708
DpnII	GATC	5 cut(s)	23, 89, 498, 640, 706
DraI	TTTAAA	1 cut(s)	78
DraIII	CACNNNGTG	1 cut(s)	203
EaeI	YGGCCR	1 cut(s)	3
Eco105I	TACGTA	1 cut(s)	65
Eco47I	GGWCC	1 cut(s)	397
EcoO109I	RGGNCCY	1 cut(s)	397
EcoRII	CCWGG	1 cut(s)	127
EcoT22I	ATGCAT	1 cut(s)	309
FaeI	CATG	5 cut(s)	45, 98, 255, 268, 311
FalI	AAGNNNNNCTT	2 cut(s)	514, 546
FatI	CATG	5 cut(s)	41, 94, 251, 264, 307
FbaI	TGATCA	1 cut(s)	498
Fnu4HI	GCNGC	1 cut(s)	680
FokI	GGATG	6 cut(s)	98, 120, 167, 352, 557, 617
Fsp4HI	GCNGC	1 cut(s)	680
FspBI	CTAG	3 cut(s)	234, 459, 549
GluI	GCNGC	1 cut(s)	680
HaeIII	GGCC	2 cut(s)	5, 529
Hin1II	CATG	5 cut(s)	45, 98, 255, 268, 311
HinfI	GANTC	5 cut(s)	382, 455, 539, 580, 728
Hpy188III	TCNNGA	1 cut(s)	386
HpyAV	CCTTC	1 cut(s)	205
HpyCH4IV	ACGT	1 cut(s)	64
HpyCH4V	TGCA	8 cut(s)	30, 197, 225, 257, 307, 534, 599, 608
HpyF10VI	GCNNNNNNNGC	3 cut(s)	605, 642, 651
HpyF3I	CTNAG	4 cut(s)	104, 200, 370, 637
HpySE526I	ACGT	1 cut(s)	64
Hsp92II	CATG	5 cut(s)	45, 98, 255, 268, 311
Ksp22I	TGATCA	1 cut(s)	498
Kzo9I	GATC	5 cut(s)	23, 89, 498, 640, 706
LpnPI	CCDG	6 cut(s)	114, 141, 204, 363, 379, 474
Lsp1109I	GCAGC	1 cut(s)	666
LweI	GCATC	4 cut(s)	184, 234, 595, 635
MaeI	CTAG	3 cut(s)	234, 459, 549
MaeII	ACGT	1 cut(s)	64
MaeIII	GTNAC	3 cut(s)	157, 361, 461
MalI	GATC	5 cut(s)	25, 91, 500, 642, 708
MboI	GATC	5 cut(s)	23, 89, 498, 640, 706
MboII	GAAGA	1 cut(s)	281
MflI	RGATCY	2 cut(s)	23, 706
MlsI	TGGCCA	1 cut(s)	5
MluCI	AATT	9 cut(s)	121, 279, 353, 437, 484, 514, 585, 590, 720
MluNI	TGGCCA	1 cut(s)	5
MlyI	GAGTC	2 cut(s)	376, 533
MmeI	TCCRAC	1 cut(s)	317
MnlI	CCTC	4 cut(s)	176, 304, 367, 370
Mox20I	TGGCCA	1 cut(s)	5
Mph1103I	ATGCAT	1 cut(s)	309
MscI	TGGCCA	1 cut(s)	5
MseI	TTAA	5 cut(s)	77, 356, 425, 483, 588
Msp20I	TGGCCA	1 cut(s)	5
MspR9I	CCNGG	1 cut(s)	129
MvaI	CCWGG	1 cut(s)	129
MwoI	GCNNNNNNNGC	3 cut(s)	605, 642, 651
NdeII	GATC	5 cut(s)	23, 89, 498, 640, 706
NlaIII	CATG	5 cut(s)	45, 98, 255, 268, 311
NlaIV	GGNNCC	1 cut(s)	398
NmuCI	GTSAC	2 cut(s)	361, 461
NsiI	ATGCAT	1 cut(s)	309
NspI	RCATGY	2 cut(s)	45, 255
PciI	ACATGT	2 cut(s)	41, 251
PfeI	GAWTC	3 cut(s)	455, 580, 728
PkrI	GCNGC	1 cut(s)	681
PleI	GAGTC	2 cut(s)	376, 533
PpsI	GAGTC	2 cut(s)	376, 533
Ppu21I	YACGTR	1 cut(s)	65
PpuMI	RGGWCCY	1 cut(s)	397
PscI	ACATGT	2 cut(s)	41, 251
PshBI	ATTAAT	1 cut(s)	483
Psp5II	RGGWCCY	1 cut(s)	397
Psp6I	CCWGG	1 cut(s)	127
PspGI	CCWGG	1 cut(s)	127
PspN4I	GGNNCC	1 cut(s)	398
PspPI	GGNCC	1 cut(s)	397
PspPPI	RGGWCCY	1 cut(s)	397
PsuI	RGATCY	2 cut(s)	23, 706
RsaI	GTAC	2 cut(s)	46, 63
RsaNI	GTAC	2 cut(s)	45, 62
SaqAI	TTAA	5 cut(s)	77, 356, 425, 483, 588
SatI	GCNGC	1 cut(s)	680
Sau3AI	GATC	5 cut(s)	23, 89, 498, 640, 706
Sau96I	GGNCC	1 cut(s)	397
SchI	GAGTC	2 cut(s)	376, 533
ScrFI	CCNGG	1 cut(s)	129
SetI	ASST	9 cut(s)	19, 67, 105, 133, 216, 315, 352, 468, 681
SfaNI	GCATC	4 cut(s)	184, 234, 595, 635
SinI	GGWCC	1 cut(s)	397
SnaBI	TACGTA	1 cut(s)	65
Sse9I	AATT	9 cut(s)	121, 279, 353, 437, 484, 514, 585, 590, 720
SspI	AATATT	2 cut(s)	34, 167
SspMI	CTAG	3 cut(s)	234, 459, 549
StyD4I	CCNGG	1 cut(s)	127
TaiI	ACGT	1 cut(s)	67
TasI	AATT	9 cut(s)	121, 279, 353, 437, 484, 514, 585, 590, 720
TatI	WGTACW	1 cut(s)	44
TfiI	GAWTC	3 cut(s)	455, 580, 728
Tru1I	TTAA	5 cut(s)	77, 356, 425, 483, 588
Tru9I	TTAA	5 cut(s)	77, 356, 425, 483, 588
TscAI	CASTG	1 cut(s)	204
TseFI	GTSAC	2 cut(s)	361, 461
TseI	GCWGC	1 cut(s)	679
Tsp45I	GTSAC	2 cut(s)	361, 461
TspDTI	ATGAA	3 cut(s)	253, 291, 583
TspRI	CASTG	1 cut(s)	204
VpaK11BI	GGWCC	1 cut(s)	397
VspI	ATTAAT	1 cut(s)	483
XapI	RAATTY	3 cut(s)	437, 514, 590
XceI	RCATGY	2 cut(s)	45, 255
XspI	CTAG	3 cut(s)	234, 459, 549
Zsp2I	ATGCAT	1 cut(s)	309

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.