Basic Information

Type: gene

Biological Identity

Species

rosa_samantha

Chromosome

Chr7C

Orthogroup ID

OG0023205

Physical Location & Seq

Genomic Coordinates Forward (+)

28978808 .. 28990745

Gene Structure 11938 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rh7CG285400.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 252 bp

ATGATGCTACCTTCAATAGGCTTCGATAAGATTCTGAAGCACCATATCAAGATTGTTCTCCCTGGCTTGACGGCTGAGTTGAATTCTCAGATGAATCCTATTTATAAGGAACTACAAACATATTCTTTTACTACATGTGGTCAGTTAAGAGAGATGGATTTCGCGGCCAATCATTTCAAAACTGGTGCGGCTGCTTTCCCAATCGATTCAAATCTGACTTACCAAATTGGAGCCCAACATCAGTTGTTGTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0005488 GO:0005515 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005777 GO:0008017 GO:0008092 GO:0015631 GO:0042579 GO:0042802 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044424 GO:0044444 GO:0044464

KEGG Pathways

Metabolic & Signaling

ko04139 ko04214 ko04217 ko04621 ko04668 map04139 map04214 map04217 map04621 map04668

Pfam Domains

Protein Families

Dynamin_M Dynamin_N GED

Protein Analysis

83

Amino Acids

9.32

Weight (kDa)

6.89

Isoelectric Point (pI)

25.28

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0023205)

Species	Orthologous Gene IDs
rosa_roxburghii	Rroxscaffold_2G00116860 Rroxscaffold_3G00246650
rosa_rugosa	Rorug01G0078100
rosa_samantha	Rh7CG285400

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	105
AccII	CGCG	1 cut(s)	164
AciI	CCGC	2 cut(s)	164, 188
AcoI	YGGCCR	1 cut(s)	165
AcsI	RAATTY	1 cut(s)	82
AcuI	CTGAAG	1 cut(s)	56
AfiI	CCNNNNNNNGG	1 cut(s)	17
AflIII	ACRYGT	1 cut(s)	134
AgsI	TTSAA	4 cut(s)	15, 82, 178, 210
AjnI	CCWGG	1 cut(s)	61
AoxI	GGCC	1 cut(s)	165
ApeKI	GCWGC	1 cut(s)	191
ApoI	RAATTY	1 cut(s)	82
BanII	GRGCYC	1 cut(s)	235
BbvI	GCAGC	1 cut(s)	178
BccI	CCATC	1 cut(s)	148
BceAI	ACGGC	1 cut(s)	87
BciT130I	CCWGG	1 cut(s)	63
BisI	GCNGC	3 cut(s)	165, 189, 192
BlsI	GCNGC	3 cut(s)	166, 190, 193
Bme1390I	CCNGG	1 cut(s)	63
BmiI	GGNNCC	1 cut(s)	232
BmrFI	CCNGG	1 cut(s)	63
Bsa29I	ATCGAT	1 cut(s)	204
BsaBI	GATNNNNATC	1 cut(s)	210
BsaJI	CCNNGG	1 cut(s)	61
Bsc4I	CCNNNNNNNGG	1 cut(s)	17
Bse1I	ACTGG	1 cut(s)	187
Bse8I	GATNNNNATC	1 cut(s)	210
BseBI	CCWGG	1 cut(s)	63
BseCI	ATCGAT	1 cut(s)	204
BseDI	CCNNGG	1 cut(s)	61
BseJI	GATNNNNATC	1 cut(s)	210
BseLI	CCNNNNNNNGG	1 cut(s)	17
BseMII	CTCAG	2 cut(s)	66, 101
BseNI	ACTGG	1 cut(s)	187
BseXI	GCAGC	1 cut(s)	178
Bsh1236I	CGCG	1 cut(s)	164
BshFI	GGCC	1 cut(s)	167
BshVI	ATCGAT	1 cut(s)	204
BslI	CCNNNNNNNGG	1 cut(s)	17
BsnI	GGCC	1 cut(s)	167
Bsp1286I	GDGCHC	1 cut(s)	235
BspACI	CCGC	2 cut(s)	164, 188
BspANI	GGCC	1 cut(s)	167
BspCNI	CTCAG	2 cut(s)	67, 100
BspDI	ATCGAT	1 cut(s)	204
BspFNI	CGCG	1 cut(s)	164
BspLI	GGNNCC	1 cut(s)	232
BsrI	ACTGG	1 cut(s)	187
BssECI	CCNNGG	1 cut(s)	61
Bst2UI	CCWGG	1 cut(s)	63
BstDEI	CTNAG	2 cut(s)	75, 87
BstENI	CCTNNNNNAGG	1 cut(s)	15
BstFNI	CGCG	1 cut(s)	164
BstNI	CCWGG	1 cut(s)	63
BstNSI	RCATGY	1 cut(s)	138
BstSCI	CCNGG	1 cut(s)	61
BstUI	CGCG	1 cut(s)	164
BstV1I	GCAGC	1 cut(s)	178
Bsu15I	ATCGAT	1 cut(s)	204
BsuRI	GGCC	1 cut(s)	167
BsuTUI	ATCGAT	1 cut(s)	204
ClaI	ATCGAT	1 cut(s)	204
CviAII	CATG	1 cut(s)	135
CviJI	RGCY	6 cut(s)	21, 66, 74, 167, 191, 233
CviKI_1	RGCY	6 cut(s)	21, 66, 74, 167, 191, 233
DdeI	CTNAG	2 cut(s)	75, 87
EaeI	YGGCCR	1 cut(s)	165
Eco24I	GRGCYC	1 cut(s)	235
Eco57I	CTGAAG	1 cut(s)	56
EcoNI	CCTNNNNNAGG	1 cut(s)	15
EcoRI	GAATTC	1 cut(s)	82
EcoRII	CCWGG	1 cut(s)	61
EcoT38I	GRGCYC	1 cut(s)	235
FaeI	CATG	1 cut(s)	138
FaiI	YATR	4 cut(s)	45, 105, 121, 136
FatI	CATG	1 cut(s)	134
Fnu4HI	GCNGC	3 cut(s)	165, 189, 192
FriOI	GRGCYC	1 cut(s)	235
Fsp4HI	GCNGC	3 cut(s)	165, 189, 192
GluI	GCNGC	3 cut(s)	165, 189, 192
HaeIII	GGCC	1 cut(s)	167
Hin1II	CATG	1 cut(s)	138
HinfI	GANTC	3 cut(s)	31, 94, 206
Hpy188I	TCNGA	3 cut(s)	36, 90, 216
Hpy188III	TCNNGA	1 cut(s)	49
HpyAV	CCTTC	1 cut(s)	21
HpyF3I	CTNAG	2 cut(s)	75, 87
Hsp92II	CATG	1 cut(s)	138
LmnI	GCTCC	1 cut(s)	230
LpnPI	CCDG	3 cut(s)	48, 75, 168
Lsp1109I	GCAGC	1 cut(s)	178
MhlI	GDGCHC	1 cut(s)	235
MluCI	AATT	2 cut(s)	82, 225
MseI	TTAA	1 cut(s)	146
MspR9I	CCNGG	1 cut(s)	63
MvaI	CCWGG	1 cut(s)	63
MvnI	CGCG	1 cut(s)	164
NlaIII	CATG	1 cut(s)	138
NlaIV	GGNNCC	1 cut(s)	232
NspI	RCATGY	1 cut(s)	138
PciI	ACATGT	1 cut(s)	134
PfeI	GAWTC	3 cut(s)	31, 94, 206
PkrI	GCNGC	3 cut(s)	166, 190, 193
PscI	ACATGT	1 cut(s)	134
PsiI	TTATAA	1 cut(s)	105
Psp6I	CCWGG	1 cut(s)	61
PspGI	CCWGG	1 cut(s)	61
PspN4I	GGNNCC	1 cut(s)	232
SaqAI	TTAA	1 cut(s)	146
SatI	GCNGC	3 cut(s)	165, 189, 192
ScrFI	CCNGG	1 cut(s)	63
SduI	GDGCHC	1 cut(s)	235
SetI	ASST	1 cut(s)	13
SgeI	CNNG	7 cut(s)	61, 74, 75, 79, 147, 175, 195
Sse9I	AATT	2 cut(s)	82, 225
SsiI	CCGC	2 cut(s)	164, 188
StyD4I	CCNGG	1 cut(s)	61
TaqI	TCGA	2 cut(s)	24, 204
TasI	AATT	2 cut(s)	82, 225
TauI	GCSGC	2 cut(s)	167, 191
TfiI	GAWTC	3 cut(s)	31, 94, 206
Tru1I	TTAA	1 cut(s)	146
Tru9I	TTAA	1 cut(s)	146
TseI	GCWGC	1 cut(s)	191
TspDTI	ATGAA	1 cut(s)	107
XagI	CCTNNNNNAGG	1 cut(s)	15
XapI	RAATTY	1 cut(s)	82
XceI	RCATGY	1 cut(s)	138

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.