Rh7CG460300
TCP Family

Belongs to the chaperonin (HSP60) family

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7C
Physical Location & Seq
Forward (+)
61069167 .. 61091455
22289 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7CG460300.1

Sequence Viewer

Length: 186 bp
ATGACAAAGGAGAAGTTGCAGGAGAGACTGGCAAAACTTTCTGGTGGTGTTGCTATGTTCAAGATTGGAGGAGCTAGTGAAGCTAAAGTTAGTGAGAAGAAGGATAGGGTTACTGATGCCTTGACTACCACAAAGGCAGCCGTTGAAGAGGGTATAGTACCAGCTATTGGATATTATGATAGGTAG
Functional Annotation
Pfam Domains
Protein Families

Protein Analysis

61

Amino Acids

6.56

Weight (kDa)

9.05

Isoelectric Point (pI)

28.33

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0020556)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 167
AfaI GTAC 1 cut(s) 159
AfiI CCNNNNNNNGG 1 cut(s) 167
AgsI TTSAA 2 cut(s) 61, 146
AluBI AGCT 3 cut(s) 74, 83, 164
AluI AGCT 3 cut(s) 74, 83, 164
Alw26I GTCTC 1 cut(s) 19
ApeKI GCWGC 1 cut(s) 137
BbvI GCAGC 1 cut(s) 149
BceAI ACGGC 1 cut(s) 125
BcoDI GTCTC 1 cut(s) 19
BfaI CTAG 1 cut(s) 75
BisI GCNGC 1 cut(s) 138
BlsI GCNGC 1 cut(s) 139
BmsI GCATC 1 cut(s) 106
Bsc4I CCNNNNNNNGG 1 cut(s) 167
Bse1I ACTGG 1 cut(s) 33
BseLI CCNNNNNNNGG 1 cut(s) 167
BseNI ACTGG 1 cut(s) 33
BseRI GAGGAG 1 cut(s) 84
BseXI GCAGC 1 cut(s) 149
BslI CCNNNNNNNGG 1 cut(s) 167
BsmAI GTCTC 1 cut(s) 19
BsrI ACTGG 1 cut(s) 33
Bst6I CTCTTC 1 cut(s) 141
BstMAI GTCTC 1 cut(s) 19
BstMWI GCNNNNNNNGC 1 cut(s) 80
BstV1I GCAGC 1 cut(s) 149
Csp6I GTAC 1 cut(s) 158
CviJI RGCY 4 cut(s) 74, 83, 140, 164
CviKI_1 RGCY 4 cut(s) 74, 83, 140, 164
CviQI GTAC 1 cut(s) 158
Eam1104I CTCTTC 1 cut(s) 141
EarI CTCTTC 1 cut(s) 141
FaiI YATR 3 cut(s) 56, 155, 177
Fnu4HI GCNGC 1 cut(s) 138
Fsp4HI GCNGC 1 cut(s) 138
FspBI CTAG 1 cut(s) 75
GluI GCNGC 1 cut(s) 138
Hpy188III TCNNGA 1 cut(s) 61
HpyAV CCTTC 1 cut(s) 94
HpyCH4V TGCA 1 cut(s) 19
HpyF10VI GCNNNNNNNGC 1 cut(s) 80
LmnI GCTCC 1 cut(s) 71
LpnPI CCDG 4 cut(s) 5, 14, 27, 174
Lsp1109I GCAGC 1 cut(s) 149
LweI GCATC 1 cut(s) 106
MaeI CTAG 1 cut(s) 75
MaeIII GTNAC 1 cut(s) 109
MboII GAAGA 2 cut(s) 109, 158
MnlI CCTC 2 cut(s) 62, 142
MwoI GCNNNNNNNGC 1 cut(s) 80
PflMI CCANNNNNTGG 1 cut(s) 167
PkrI GCNGC 1 cut(s) 139
RsaI GTAC 1 cut(s) 159
RsaNI GTAC 1 cut(s) 158
SatI GCNGC 1 cut(s) 138
SetI ASST 4 cut(s) 76, 85, 166, 185
SfaNI GCATC 1 cut(s) 106
SgeI CNNG 7 cut(s) 32, 41, 54, 73, 87, 133, 173
SspMI CTAG 1 cut(s) 75
TseI GCWGC 1 cut(s) 137
Van91I CCANNNNNTGG 1 cut(s) 167
XspI CTAG 1 cut(s) 75
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.