Rh7DG124400

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7D
Physical Location & Seq
Forward (+)
10491319 .. 10492528
1210 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7DG124400.1

Sequence Viewer

Length: 195 bp
ATGGTGAAGGTCGCAACCTACTTCGCTATGACTTTGGGAGCTTTCGTTTTCTGGCAAACCATGGATAAAGTCCACGTCTGGATCGCTCTGCATCAGGACGAAAAGCAAGAAAGACTGGAAAGGGAAATGGAAGTTAAGAGGTATAGAGAAGAGCTACTTCAGGAGCAAGCCAGACAAAGGAAGGCCGAAGCATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

64

Amino Acids

7.83

Weight (kDa)

6.73

Isoelectric Point (pI)

33.39

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0017207)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G67785
malus_domestica MD06G1161100.v1.1 MD14G1166500.v1.1
prunus_persica Prupe.5G160800_v2.0.a1
pyrus_communis pycom14g13910
rosa_chinensis RchiOBHm_Chr7g0191781
rosa_roxburghii Rroxscaffold_3G00263540
rosa_rugosa Rorug06G0511300
rosa_samantha Rh7AG121100 Rh7BG122800 Rh7CG125700 Rh7DG124400
rosa_wichuraiana Rw7G010320

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 89
AcuI CTGAAG 1 cut(s) 143
AfiI CCNNNNNNNGG 1 cut(s) 177
AjiI CACGTC 1 cut(s) 76
AluBI AGCT 2 cut(s) 41, 154
AluI AGCT 2 cut(s) 41, 154
AlwI GGATC 1 cut(s) 89
AoxI GGCC 1 cut(s) 183
AsuHPI GGTGA 1 cut(s) 16
BmgBI CACGTC 1 cut(s) 76
BmsI GCATC 1 cut(s) 100
BsaJI CCNNGG 1 cut(s) 60
BsaXI ACNNNNNCTCC 2 cut(s) 30, 60
Bsc4I CCNNNNNNNGG 1 cut(s) 177
Bse1I ACTGG 1 cut(s) 120
BseDI CCNNGG 1 cut(s) 60
BseLI CCNNNNNNNGG 1 cut(s) 177
BseNI ACTGG 1 cut(s) 120
BshFI GGCC 1 cut(s) 185
BslI CCNNNNNNNGG 1 cut(s) 177
BsnI GGCC 1 cut(s) 185
Bsp143I GATC 1 cut(s) 81
Bsp19I CCATGG 1 cut(s) 60
BspANI GGCC 1 cut(s) 185
BspPI GGATC 1 cut(s) 89
BspQI GCTCTTC 1 cut(s) 144
BsrI ACTGG 1 cut(s) 120
BssECI CCNNGG 1 cut(s) 60
BssMI GATC 1 cut(s) 81
BssT1I CCWWGG 1 cut(s) 60
Bst6I CTCTTC 1 cut(s) 144
BstC8I GCNNGC 1 cut(s) 168
BstDSI CCRYGG 1 cut(s) 60
BstKTI GATC 1 cut(s) 84
BstMBI GATC 1 cut(s) 81
BsuRI GGCC 1 cut(s) 185
BtgI CCRYGG 1 cut(s) 60
BtrI CACGTC 1 cut(s) 76
Cac8I GCNNGC 1 cut(s) 168
CviAII CATG 2 cut(s) 61, 192
CviJI RGCY 4 cut(s) 41, 154, 170, 185
CviKI_1 RGCY 4 cut(s) 41, 154, 170, 185
DpnI GATC 1 cut(s) 83
DpnII GATC 1 cut(s) 81
Eam1104I CTCTTC 1 cut(s) 144
EarI CTCTTC 1 cut(s) 144
Eco130I CCWWGG 1 cut(s) 60
Eco57I CTGAAG 1 cut(s) 143
EcoT14I CCWWGG 1 cut(s) 60
ErhI CCWWGG 1 cut(s) 60
FaeI CATG 2 cut(s) 64, 195
FaiI YATR 4 cut(s) 29, 62, 144, 193
FalI AAGNNNNNCTT 2 cut(s) 141, 173
FatI CATG 2 cut(s) 60, 191
HaeIII GGCC 1 cut(s) 185
Hin1II CATG 2 cut(s) 64, 195
HphI GGTGA 1 cut(s) 16
Hpy166II GTNNAC 1 cut(s) 73
Hpy188III TCNNGA 3 cut(s) 79, 95, 161
Hpy8I GTNNAC 1 cut(s) 73
HpyAV CCTTC 1 cut(s) 175
HpyCH4IV ACGT 1 cut(s) 75
HpyCH4V TGCA 1 cut(s) 91
HpySE526I ACGT 1 cut(s) 75
Hsp92II CATG 2 cut(s) 64, 195
Kzo9I GATC 1 cut(s) 81
LguI GCTCTTC 1 cut(s) 144
LmnI GCTCC 2 cut(s) 38, 163
LpnPI CCDG 6 cut(s) 37, 64, 80, 101, 146, 184
LweI GCATC 1 cut(s) 100
MaeII ACGT 1 cut(s) 75
MalI GATC 1 cut(s) 83
MboI GATC 1 cut(s) 81
MboII GAAGA 1 cut(s) 161
MnlI CCTC 1 cut(s) 132
MseI TTAA 1 cut(s) 135
NcoI CCATGG 1 cut(s) 60
NdeII GATC 1 cut(s) 81
NlaIII CATG 2 cut(s) 64, 195
PciSI GCTCTTC 1 cut(s) 144
SapI GCTCTTC 1 cut(s) 144
SaqAI TTAA 1 cut(s) 135
Sau3AI GATC 1 cut(s) 81
SetI ASST 6 cut(s) 12, 20, 43, 78, 143, 156
SfaNI GCATC 1 cut(s) 100
StyI CCWWGG 1 cut(s) 60
TaiI ACGT 1 cut(s) 78
Tru1I TTAA 1 cut(s) 135
Tru9I TTAA 1 cut(s) 135
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.