Rh7DG422600

callose synthase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7D
OG0021272
Physical Location & Seq
Reverse (-)
59716348 .. 59717402
1055 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7DG422600.1

Sequence Viewer

Length: 306 bp
ATGCCAATGTCTTCAGAATTATTTTCCGGCATAGTTCGTTGGCCAGTTTTTCTTCTTGCAAATAAGTTTTCAACTGCCCTGAGTATTGCAAAGGATTTTGTGGGGAGGGATGAAAGTCTTGTCAGAAGACTTAAAAAAGATGAGTACATGTACTGTGCTATGAAGGAGTGCTACGAATCATTGAAATACATCCTTGAAATCCTCATTATTGGGGATCTCGAAAAGAGGATTGTATCTGCCATACTGACTGAAATTGAAGAAAGCATCACAAGATCAATTGGTTTTAATGGGATTGCTAGCAAGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
FKS1_dom1 Glucan_synthase Vta1

Protein Analysis

101

Amino Acids

11.53

Weight (kDa)

6.29

Isoelectric Point (pI)

71.76

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
CALS1 PF25968 15 - 91 1.6e-25 Callose synthase 1 domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0021272)

Species Orthologous Gene IDs
pyrus_communis pycom09g06970
rosa_multiflora Rmu_sc0005378.1_g000035
rosa_samantha Rh6AG329000 Rh7AG299100 Rh7DG422600

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 222
AcoI YGGCCR 1 cut(s) 41
AfaI GTAC 2 cut(s) 146, 152
AflIII ACRYGT 1 cut(s) 147
AgsI TTSAA 4 cut(s) 72, 184, 197, 257
AlwI GGATC 1 cut(s) 222
AoxI GGCC 1 cut(s) 41
AsuNHI GCTAGC 1 cut(s) 296
BalI TGGCCA 1 cut(s) 43
BarI GAAGNNNNNNTAC 2 cut(s) 155, 187
BbsI GAAGAC 2 cut(s) 3, 133
BfaI CTAG 1 cut(s) 297
BmsI GCATC 1 cut(s) 273
BmtI GCTAGC 1 cut(s) 300
BpiI GAAGAC 2 cut(s) 3, 133
Bse1I ACTGG 1 cut(s) 44
BseGI GGATG 2 cut(s) 115, 189
BseMII CTCAG 1 cut(s) 71
BseNI ACTGG 1 cut(s) 44
BshFI GGCC 1 cut(s) 43
BsiSI CCGG 1 cut(s) 27
BsnI GGCC 1 cut(s) 43
Bsp143I GATC 2 cut(s) 214, 272
BspANI GGCC 1 cut(s) 43
BspCNI CTCAG 1 cut(s) 72
BspOI GCTAGC 1 cut(s) 300
BspPI GGATC 1 cut(s) 222
BsrI ACTGG 1 cut(s) 44
BssMI GATC 2 cut(s) 214, 272
Bst4CI ACNGT 1 cut(s) 155
BstC8I GCNNGC 1 cut(s) 298
BstDEI CTNAG 1 cut(s) 80
BstF5I GGATG 2 cut(s) 115, 189
BstKTI GATC 2 cut(s) 217, 275
BstMBI GATC 2 cut(s) 214, 272
BstNSI RCATGY 1 cut(s) 151
BstV2I GAAGAC 2 cut(s) 3, 133
BstX2I RGATCY 1 cut(s) 214
BstYI RGATCY 1 cut(s) 214
BsuRI GGCC 1 cut(s) 43
BtsCI GGATG 2 cut(s) 115, 189
Cac8I GCNNGC 1 cut(s) 298
Csp6I GTAC 2 cut(s) 145, 151
CviAII CATG 1 cut(s) 148
CviJI RGCY 1 cut(s) 43
CviKI_1 RGCY 1 cut(s) 43
CviQI GTAC 2 cut(s) 145, 151
DdeI CTNAG 1 cut(s) 80
DpnI GATC 2 cut(s) 216, 274
DpnII GATC 2 cut(s) 214, 272
EaeI YGGCCR 1 cut(s) 41
FaeI CATG 1 cut(s) 151
FaiI YATR 4 cut(s) 32, 149, 161, 242
FatI CATG 1 cut(s) 147
FokI GGATG 2 cut(s) 122, 176
FspBI CTAG 1 cut(s) 297
HaeIII GGCC 1 cut(s) 43
HapII CCGG 1 cut(s) 27
Hin1II CATG 1 cut(s) 151
HinfI GANTC 1 cut(s) 176
HpaII CCGG 1 cut(s) 27
Hpy188I TCNGA 2 cut(s) 16, 125
Hpy188III TCNNGA 1 cut(s) 218
HpyAV CCTTC 1 cut(s) 157
HpyCH4III ACNGT 1 cut(s) 155
HpyCH4V TGCA 2 cut(s) 59, 89
HpyF3I CTNAG 1 cut(s) 80
Hsp92II CATG 1 cut(s) 151
Kzo9I GATC 2 cut(s) 214, 272
LpnPI CCDG 3 cut(s) 40, 57, 92
LweI GCATC 1 cut(s) 273
MaeI CTAG 1 cut(s) 297
MalI GATC 2 cut(s) 216, 274
MboI GATC 2 cut(s) 214, 272
MboII GAAGA 4 cut(s) 3, 44, 138, 269
MfeI CAATTG 1 cut(s) 276
MflI RGATCY 1 cut(s) 214
MlsI TGGCCA 1 cut(s) 43
MluCI AATT 3 cut(s) 17, 252, 276
MluNI TGGCCA 1 cut(s) 43
MnlI CCTC 3 cut(s) 99, 212, 219
Mox20I TGGCCA 1 cut(s) 43
MscI TGGCCA 1 cut(s) 43
MseI TTAA 2 cut(s) 132, 285
Msp20I TGGCCA 1 cut(s) 43
MspI CCGG 1 cut(s) 27
MunI CAATTG 1 cut(s) 276
NdeII GATC 2 cut(s) 214, 272
NheI GCTAGC 1 cut(s) 296
NlaIII CATG 1 cut(s) 151
NspI RCATGY 1 cut(s) 151
PciI ACATGT 1 cut(s) 147
PfeI GAWTC 1 cut(s) 176
PscI ACATGT 1 cut(s) 147
PsuI RGATCY 1 cut(s) 214
RsaI GTAC 2 cut(s) 146, 152
RsaNI GTAC 2 cut(s) 145, 151
SaqAI TTAA 2 cut(s) 132, 285
Sau3AI GATC 2 cut(s) 214, 272
SfaNI GCATC 1 cut(s) 273
SgeI CNNG 9 cut(s) 39, 56, 68, 91, 131, 160, 206, 230, 282
Sse9I AATT 3 cut(s) 17, 252, 276
SspMI CTAG 1 cut(s) 297
TaaI ACNGT 1 cut(s) 155
TaqI TCGA 1 cut(s) 219
TasI AATT 3 cut(s) 17, 252, 276
TatI WGTACW 2 cut(s) 144, 150
TfiI GAWTC 1 cut(s) 176
Tru1I TTAA 2 cut(s) 132, 285
Tru9I TTAA 2 cut(s) 132, 285
TspDTI ATGAA 2 cut(s) 126, 176
XceI RCATGY 1 cut(s) 151
XspI CTAG 1 cut(s) 297
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.