Rw1G025040

Ubiquitin exists either covalently attached to another protein, or free (unanchored). When covalently bound, it is conjugated to target proteins via an isopeptide bond either as a monomer (monoubiquitin), a polymer linked via different Lys residues of the ubiquitin (polyubiquitin chains) or a linear polymer linked via the initiator Met of the ubiquitin (linear polyubiquitin chains). Polyubiquitin chains, when attached to a target protein, have different functions depending on the Lys residue of the ubiquitin that is linked

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr1
OG0018273
Physical Location & Seq
Reverse (-)
51643040 .. 51656794
13755 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw1G025040.1

Sequence Viewer

Length: 1290 bp
ATGCAGATCTTTGTGAAGACGATCACAGGGAAGACCATTACCCTTGAGGTGGAAAGCTCTGATACTATAGACGATGATAGAATCCTAGATGAGTTGGGAATCCAAATAGAAGTGCAGAGGCTGATCTATGCTGGGAAGCAACTGGAGGATTGGCGTACCCTAGCTGATTGTAGCATCCAGAATGAATCAACCCTAGACCTCGTGCTCCTTCCCCATCCTCCGAGGAGGATGCAGATTTTTGATCATCACTCTCGACGTGGAGCTTTTGATACAATTGAAAATGTCAAGGCCAAAATCCAACTTAAAGCGGGCATCCCGAAACAACACCAGAGGCTCTTCTTTGCTGGGAAGCAACTGGACAACTCGCGTACTCTGTATGATTATAACATCATCAGAGGAAACTGTAATATCTGGGAGAACTATACTTTACGTCTGGTCTTCGGAATGCAGATCTTTGTCGAAATCCAAAATGGGAGGACAATCGCTCTTGAGCTCGAGAGTTCTGAGGGCATTCCACCAATAAACCAGAGGCTTATTTTTGCTGGGAAGCAACTTGAGGATGGGAGGAGAACTCTGGCTGATTGTAGCATCCAGAATGAGTCTACCCTTGAGCTTCGTGTTCGAGGATCGATACATTGGCCAACTTTCGTTAGTACTTTGACTGGCAAGACCATAAGCCTTGAGGTGGAGAGCTCTGATACCATAGAACATGTCAAAGCACGGATTCAGGTGGAGAGCTCTGATACTATAGCACATGTCAAAGCATGGATTCAAGACCAAAAATTGCTTATGTTTCACGGACAACAGCTTGAGGATGGCATGACTTTGGCAGATTATCATATCAGGAAGAGATCTACTTTACATCTTGTTTTCGGAATGCAGATTGTCAGGTCTGATACCATTCATGATGTTAAGGCTAAAATCCAAGAGAGAGTGGGTGTCCCACCAAGTAGACAGAGGCTTATCTTTGCTGGGAGGCAACTGGAGGGTGGGAGCACTCTGGCTGATTGTAGCATCCAGAATGAGTCTAATCTCGACCGGCCTTCTGCTTCCTCTTCGGGAATGTGTATCTTTGTCATACATCTCGGTGGGAAGATAACCATTCTTGAGGTGCTTCGGAGTTCTGATCCAATTGGCAGTGTCATTGAAAAAATACATGATAAGGAGGGCATCCCACCACATGACCAGAGGCTTCTTCTTGGTGGCCTGCGACTTGAGGAAGCACGAACTCTTGCTCATTATAACATCCACAGTGATACTACCCTGTACCTTGTGCTTCAACATCGTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko03320 map03320
Pfam Domains
Protein Families
ubiquitin

Protein Analysis

429

Amino Acids

48.64

Weight (kDa)

6.39

Isoelectric Point (pI)

42.38

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Rad60-SLD PF11976 1 - 69 7.9e-08 Ubiquitin-2 like Rad60 SUMO-like
ubiquitin PF00240 3 - 69 4.3e-18 Ubiquitin family
ubiquitin PF00240 90 - 131 2.4e-11 Ubiquitin family
ubiquitin PF00240 164 - 208 3.2e-10 Ubiquitin family
ubiquitin PF00240 216 - 291 1.4e-14 Ubiquitin family
ubiquitin PF00240 292 - 344 2e-15 Ubiquitin family
Rad60-SLD PF11976 292 - 346 1.1e-07 Ubiquitin-2 like Rad60 SUMO-like
ubiquitin PF00240 357 - 427 7.3e-13 Ubiquitin family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0018273)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G11970
prunus_persica Prupe.4G204200_v2.0.a1
rosa_chinensis RchiOBHm_Chr1g0359151
rosa_multiflora Rmu_sc0010589.1_g000003 Rmu_ssc0000135.1_g000004
rosa_rugosa Rorug03G0165600
rosa_samantha Rh1AG281700 Rh1CG266100 Rh1DG277200
rosa_wichuraiana Rw1G025040

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 2 cut(s) 384, 1242
AccI GTMKAC 2 cut(s) 602, 952
AccII CGCG 1 cut(s) 367
AciI CCGC 1 cut(s) 308
AclWI GGATC 2 cut(s) 634, 1121
AcoI YGGCCR 1 cut(s) 638
AfaI GTAC 4 cut(s) 157, 370, 655, 1268
AfiI CCNNNNNNNGG 2 cut(s) 49, 685
AflIII ACRYGT 2 cut(s) 709, 754
AgsI TTSAA 4 cut(s) 278, 773, 1148, 1280
AjiI CACGTC 1 cut(s) 257
AluBI AGCT 8 cut(s) 57, 164, 263, 493, 613, 693, 738, 808
AluI AGCT 8 cut(s) 57, 164, 263, 493, 613, 693, 738, 808
Alw21I GWGCWC 5 cut(s) 207, 495, 695, 740, 998
AlwI GGATC 2 cut(s) 634, 1121
AlwNI CAGNNNCTG 1 cut(s) 121
Ama87I CYCGRG 1 cut(s) 494
AoxI GGCC 4 cut(s) 288, 638, 1040, 1204
AvaI CYCGRG 1 cut(s) 494
BalI TGGCCA 1 cut(s) 640
BanII GRGCYC 3 cut(s) 495, 695, 740
BauI CACGAG 1 cut(s) 200
BbsI GAAGAC 3 cut(s) 23, 38, 430
Bbv12I GWGCWC 5 cut(s) 207, 495, 695, 740, 998
BccI CCATC 3 cut(s) 222, 554, 809
BcgI CGANNNNNNTGC 2 cut(s) 211, 245
BclI TGATCA 1 cut(s) 241
BfaI CTAG 3 cut(s) 86, 161, 194
BfmI CTRYAG 2 cut(s) 66, 747
BglII AGATCT 3 cut(s) 6, 450, 851
BmcAI AGTACT 1 cut(s) 655
BmeT110I CYCGRG 1 cut(s) 494
BmgBI CACGTC 1 cut(s) 257
BmsI GCATC 6 cut(s) 183, 219, 321, 597, 1023, 1179
BpiI GAAGAC 3 cut(s) 23, 38, 430
BplI GAGNNNNNCTC 2 cut(s) 556, 588
BpmI CTGGAG 2 cut(s) 164, 1004
BpuEI CTTGAG 8 cut(s) 65, 509, 575, 629, 701, 830, 1127, 1235
Bsa29I ATCGAT 1 cut(s) 629
BsaJI CCNNGG 1 cut(s) 221
Bsc4I CCNNNNNNNGG 2 cut(s) 49, 685
Bse118I RCCGGY 1 cut(s) 1038
Bse1I ACTGG 4 cut(s) 147, 360, 667, 987
BseCI ATCGAT 1 cut(s) 629
BseDI CCNNGG 1 cut(s) 221
BseLI CCNNNNNNNGG 2 cut(s) 49, 685
BseMII CTCAG 1 cut(s) 495
BseNI ACTGG 4 cut(s) 147, 360, 667, 987
BseRI GAGGAG 2 cut(s) 238, 580
BseYI CCCAGC 4 cut(s) 131, 344, 542, 971
BsgI GTGCAG 1 cut(s) 134
Bsh1236I CGCG 1 cut(s) 367
Bsh1285I CGRYCG 1 cut(s) 1039
BshFI GGCC 4 cut(s) 290, 640, 1042, 1206
BshVI ATCGAT 1 cut(s) 629
BsiEI CGRYCG 1 cut(s) 1039
BsiHKAI GWGCWC 5 cut(s) 207, 495, 695, 740, 998
BsiHKCI CYCGRG 1 cut(s) 494
BsiSI CCGG 1 cut(s) 1039
BslFI GGGAC 1 cut(s) 926
BslI CCNNNNNNNGG 2 cut(s) 49, 685
BsmFI GGGAC 1 cut(s) 926
BsmI GAATGC 3 cut(s) 450, 510, 882
BsnI GGCC 4 cut(s) 290, 640, 1042, 1206
BsoBI CYCGRG 1 cut(s) 494
Bsp1286I GDGCHC 5 cut(s) 207, 495, 695, 740, 998
Bsp143I GATC 8 cut(s) 6, 21, 123, 241, 450, 626, 851, 1126
BspACI CCGC 1 cut(s) 308
BspANI GGCC 4 cut(s) 290, 640, 1042, 1206
BspCNI CTCAG 1 cut(s) 496
BspDI ATCGAT 1 cut(s) 629
BspFNI CGCG 1 cut(s) 367
BspHI TCATGA 1 cut(s) 904
BspPI GGATC 2 cut(s) 634, 1121
BspQI GCTCTTC 1 cut(s) 341
BsrFI RCCGGY 1 cut(s) 1038
BsrI ACTGG 4 cut(s) 147, 360, 667, 987
BssAI RCCGGY 1 cut(s) 1038
BssECI CCNNGG 1 cut(s) 221
BssMI GATC 8 cut(s) 6, 21, 123, 241, 450, 626, 851, 1126
BssSI CACGAG 1 cut(s) 200
Bst2BI CACGAG 1 cut(s) 200
Bst4CI ACNGT 2 cut(s) 404, 1253
Bst6I CTCTTC 3 cut(s) 341, 842, 1060
BstC8I GCNNGC 2 cut(s) 310, 1208
BstDEI CTNAG 1 cut(s) 504
BstFNI CGCG 1 cut(s) 367
BstKTI GATC 8 cut(s) 9, 24, 126, 244, 453, 629, 854, 1129
BstMBI GATC 8 cut(s) 6, 21, 123, 241, 450, 626, 851, 1126
BstMCI CGRYCG 1 cut(s) 1039
BstNSI RCATGY 2 cut(s) 713, 758
BstSFI CTRYAG 2 cut(s) 66, 747
BstUI CGCG 1 cut(s) 367
BstV2I GAAGAC 3 cut(s) 23, 38, 430
BstX2I RGATCY 3 cut(s) 6, 450, 851
BstYI RGATCY 3 cut(s) 6, 450, 851
Bsu15I ATCGAT 1 cut(s) 629
BsuRI GGCC 4 cut(s) 290, 640, 1042, 1206
BsuTUI ATCGAT 1 cut(s) 629
BtrI CACGTC 1 cut(s) 257
BtsI GCAGTG 1 cut(s) 1144
BtsIMutI CAGTG 2 cut(s) 1144, 1258
Cac8I GCNNGC 2 cut(s) 310, 1208
CaiI CAGNNNCTG 1 cut(s) 121
CciI TCATGA 1 cut(s) 904
Cfr10I RCCGGY 1 cut(s) 1038
ClaI ATCGAT 1 cut(s) 629
Csp6I GTAC 4 cut(s) 156, 369, 654, 1267
CviAII CATG 7 cut(s) 710, 755, 765, 820, 905, 1157, 1181
CviQI GTAC 4 cut(s) 156, 369, 654, 1267
DdeI CTNAG 1 cut(s) 504
DpnI GATC 8 cut(s) 8, 23, 125, 243, 452, 628, 853, 1128
DpnII GATC 8 cut(s) 6, 21, 123, 241, 450, 626, 851, 1126
EaeI YGGCCR 1 cut(s) 638
Eam1104I CTCTTC 3 cut(s) 341, 842, 1060
EarI CTCTTC 3 cut(s) 341, 842, 1060
Ecl136II GAGCTC 3 cut(s) 493, 693, 738
Eco24I GRGCYC 3 cut(s) 495, 695, 740
Eco53kI GAGCTC 3 cut(s) 493, 693, 738
Eco88I CYCGRG 1 cut(s) 494
EcoICRI GAGCTC 3 cut(s) 493, 693, 738
EcoT38I GRGCYC 3 cut(s) 495, 695, 740
FaeI CATG 7 cut(s) 713, 758, 768, 823, 908, 1160, 1184
FaqI GGGAC 1 cut(s) 926
FatI CATG 7 cut(s) 709, 754, 764, 819, 904, 1156, 1180
FauI CCCGC 1 cut(s) 301
FbaI TGATCA 1 cut(s) 241
FblI GTMKAC 2 cut(s) 602, 952
FriOI GRGCYC 3 cut(s) 495, 695, 740
FspBI CTAG 3 cut(s) 86, 161, 194
GsaI CCCAGC 4 cut(s) 135, 348, 546, 975
GsuI CTGGAG 2 cut(s) 164, 1004
HaeIII GGCC 4 cut(s) 290, 640, 1042, 1206
HapII CCGG 1 cut(s) 1039
Hin1II CATG 7 cut(s) 713, 758, 768, 823, 908, 1160, 1184
HinfI GANTC 7 cut(s) 81, 99, 185, 599, 724, 769, 1025
HpaII CCGG 1 cut(s) 1039
Hpy166II GTNNAC 2 cut(s) 603, 953
Hpy8I GTNNAC 2 cut(s) 603, 953
Hpy99I CGWCG 1 cut(s) 258
HpyAV CCTTC 2 cut(s) 218, 1053
HpyCH4III ACNGT 2 cut(s) 404, 1253
HpyCH4IV ACGT 2 cut(s) 256, 430
HpyCH4V TGCA 5 cut(s) 4, 115, 232, 448, 880
HpyF3I CTNAG 1 cut(s) 504
HpySE526I ACGT 2 cut(s) 256, 430
Hsp92II CATG 7 cut(s) 713, 758, 768, 823, 908, 1160, 1184
Ksp22I TGATCA 1 cut(s) 241
Kzo9I GATC 8 cut(s) 6, 21, 123, 241, 450, 626, 851, 1126
LguI GCTCTTC 1 cut(s) 341
LmnI GCTCC 3 cut(s) 210, 260, 993
LweI GCATC 6 cut(s) 183, 219, 321, 597, 1023, 1179
MaeI CTAG 3 cut(s) 86, 161, 194
MaeII ACGT 2 cut(s) 256, 430
MalI GATC 8 cut(s) 8, 23, 125, 243, 452, 628, 853, 1128
MboI GATC 8 cut(s) 6, 21, 123, 241, 450, 626, 851, 1126
MboII GAAGA 8 cut(s) 28, 43, 328, 430, 859, 1047, 1105, 1187
MfeI CAATTG 2 cut(s) 273, 1131
MflI RGATCY 3 cut(s) 6, 450, 851
MhlI GDGCHC 5 cut(s) 207, 495, 695, 740, 998
MlsI TGGCCA 1 cut(s) 640
MluCI AATT 3 cut(s) 273, 782, 1131
MluNI TGGCCA 1 cut(s) 640
MlyI GAGTC 2 cut(s) 608, 1034
MmeI TCCRAC 1 cut(s) 322
Mox20I TGGCCA 1 cut(s) 640
MscI TGGCCA 1 cut(s) 640
MseI TTAA 2 cut(s) 303, 912
MslI CAYNNNNRTG 1 cut(s) 1086
Msp20I TGGCCA 1 cut(s) 640
MspI CCGG 1 cut(s) 1039
MunI CAATTG 2 cut(s) 273, 1131
Mva1269I GAATGC 3 cut(s) 450, 510, 882
MvnI CGCG 1 cut(s) 367
NdeII GATC 8 cut(s) 6, 21, 123, 241, 450, 626, 851, 1126
NlaIII CATG 7 cut(s) 713, 758, 768, 823, 908, 1160, 1184
NspI RCATGY 2 cut(s) 713, 758
PaeR7I CTCGAG 1 cut(s) 494
PagI TCATGA 1 cut(s) 904
PciI ACATGT 2 cut(s) 709, 754
PciSI GCTCTTC 1 cut(s) 341
PctI GAATGC 3 cut(s) 450, 510, 882
PfeI GAWTC 5 cut(s) 81, 99, 185, 724, 769
PleI GAGTC 2 cut(s) 607, 1033
PpsI GAGTC 2 cut(s) 607, 1033
PscI ACATGT 2 cut(s) 709, 754
PsiI TTATAA 2 cut(s) 384, 1242
Psp124BI GAGCTC 3 cut(s) 495, 695, 740
PspFI CCCAGC 4 cut(s) 131, 344, 542, 971
PstNI CAGNNNCTG 1 cut(s) 121
PsuI RGATCY 3 cut(s) 6, 450, 851
RsaI GTAC 4 cut(s) 157, 370, 655, 1268
RsaNI GTAC 4 cut(s) 156, 369, 654, 1267
RseI CAYNNNNRTG 1 cut(s) 1086
SacI GAGCTC 3 cut(s) 495, 695, 740
SapI GCTCTTC 1 cut(s) 341
SaqAI TTAA 2 cut(s) 303, 912
Sau3AI GATC 8 cut(s) 6, 21, 123, 241, 450, 626, 851, 1126
ScaI AGTACT 1 cut(s) 655
SchI GAGTC 2 cut(s) 608, 1034
SduI GDGCHC 5 cut(s) 207, 495, 695, 740, 998
SfaNI GCATC 6 cut(s) 183, 219, 321, 597, 1023, 1179
SfcI CTRYAG 2 cut(s) 66, 747
Sfr274I CTCGAG 1 cut(s) 494
SlaI CTCGAG 1 cut(s) 494
SmiMI CAYNNNNRTG 1 cut(s) 1086
SmlI CTYRAG 9 cut(s) 44, 488, 494, 554, 608, 680, 809, 1106, 1214
SmoI CTYRAG 9 cut(s) 44, 488, 494, 554, 608, 680, 809, 1106, 1214
Sse9I AATT 3 cut(s) 273, 782, 1131
SsiI CCGC 1 cut(s) 308
SspMI CTAG 3 cut(s) 86, 161, 194
SstI GAGCTC 3 cut(s) 495, 695, 740
TaaI ACNGT 2 cut(s) 404, 1253
TaiI ACGT 2 cut(s) 259, 433
TaqI TCGA 6 cut(s) 253, 459, 495, 622, 629, 1035
TasI AATT 3 cut(s) 273, 782, 1131
TatI WGTACW 1 cut(s) 653
TfiI GAWTC 5 cut(s) 81, 99, 185, 724, 769
Tru1I TTAA 2 cut(s) 303, 912
Tru9I TTAA 2 cut(s) 303, 912
TscAI CASTG 2 cut(s) 1144, 1258
TspDTI ATGAA 2 cut(s) 198, 893
TspGWI ACGGA 2 cut(s) 736, 813
TspRI CASTG 2 cut(s) 1144, 1258
XceI RCATGY 2 cut(s) 713, 758
XhoI CTCGAG 1 cut(s) 494
XmiI GTMKAC 2 cut(s) 602, 952
XspI CTAG 3 cut(s) 86, 161, 194
ZrmI AGTACT 1 cut(s) 655
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.