Rw5G039390

CLAVATA3 ESR (CLE)-related protein

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr5
Physical Location & Seq
Forward (+)
69500182 .. 69500885
704 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw5G039390.1

Sequence Viewer

Length: 276 bp
ATGCATCATCTTCAGCTTAAGATGGGAAGACAGAGCCACATTCATCTTCTTTTGATATGGCTCCTGCTCGCAACTTCTCAATACCACCACTACATTATTAATGCTCAAGCTCTTGAATCAGTTCAGTTCAAGCTCAATCCTGCACTGCGCAGTTCAAGGCCAGGCTCGGGAACCAGATATGCTTTACCTACTCGGGTAAGTGAAAGGAAGAGGATTCATAAAACTCCATCAGGACCCAACCCAGCAGGCAATCATCGCCCACCATCTAAGCAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

91

Amino Acids

10.37

Weight (kDa)

11.58

Isoelectric Point (pI)

82.72

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0016193)

Species Orthologous Gene IDs
arabidopsis_thaliana AT5G59305 AT5G59305
fragaria_vesca FvH4_3g35710
malus_domestica MD11G1111900.v1.1
prunus_persica Prupe.6G080300_v2.0.a1 Prupe.6G080300_v2.0.a1
pyrus_communis pycom11g09250
rosa_chinensis RchiOBHm_Chr5g0063861
rosa_laevigata RLG00000035686
rosa_multiflora Rmu_sc0000552.1_g000017
rosa_roxburghii Rroxscaffold_1G00016920
rosa_samantha Rh5AG419200 Rh5CG458300 Rh5DG448300
rosa_wichuraiana Rw5G039390

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 149
AfiI CCNNNNNNNGG 1 cut(s) 167
AflII CTTAAG 1 cut(s) 17
AgsI TTSAA 3 cut(s) 116, 130, 156
AjnI CCWGG 1 cut(s) 160
AluBI AGCT 3 cut(s) 16, 110, 133
AluI AGCT 3 cut(s) 16, 110, 133
Ama87I CYCGRG 2 cut(s) 166, 192
AoxI GGCC 1 cut(s) 158
AseI ATTAAT 1 cut(s) 99
Asp700I GAANNNNTTC 1 cut(s) 120
AspLEI GCGC 1 cut(s) 150
AspS9I GGNCC 1 cut(s) 233
AvaI CYCGRG 2 cut(s) 166, 192
AvaII GGWCC 1 cut(s) 233
BbsI GAAGAC 1 cut(s) 34
BccI CCATC 3 cut(s) 16, 235, 271
BciT130I CCWGG 1 cut(s) 162
BfrI CTTAAG 1 cut(s) 17
Bme1390I CCNGG 1 cut(s) 162
Bme18I GGWCC 1 cut(s) 233
BmeT110I CYCGRG 2 cut(s) 166, 192
BmgT120I GGNCC 1 cut(s) 233
BmiI GGNNCC 3 cut(s) 62, 172, 235
BmrFI CCNGG 1 cut(s) 162
BmsI GCATC 1 cut(s) 13
BpiI GAAGAC 1 cut(s) 34
BpuEI CTTGAG 1 cut(s) 90
Bsc4I CCNNNNNNNGG 1 cut(s) 167
BseBI CCWGG 1 cut(s) 162
BseLI CCNNNNNNNGG 1 cut(s) 167
BseYI CCCAGC 1 cut(s) 241
BsgI GTGCAG 1 cut(s) 126
BshFI GGCC 1 cut(s) 160
BsiHKCI CYCGRG 2 cut(s) 166, 192
BslI CCNNNNNNNGG 1 cut(s) 167
BsnI GGCC 1 cut(s) 160
BsoBI CYCGRG 2 cut(s) 166, 192
BspANI GGCC 1 cut(s) 160
BspLI GGNNCC 3 cut(s) 62, 172, 235
BspTI CTTAAG 1 cut(s) 17
Bst2UI CCWGG 1 cut(s) 162
Bst6I CTCTTC 1 cut(s) 203
BstAFI CTTAAG 1 cut(s) 17
BstC8I GCNNGC 2 cut(s) 69, 247
BstDEI CTNAG 1 cut(s) 267
BstHHI GCGC 1 cut(s) 150
BstMWI GCNNNNNNNGC 1 cut(s) 255
BstNI CCWGG 1 cut(s) 162
BstSCI CCNGG 1 cut(s) 160
BstV2I GAAGAC 1 cut(s) 34
BsuRI GGCC 1 cut(s) 160
BtgZI GCGATG 1 cut(s) 239
BtsI GCAGTG 1 cut(s) 143
BtsIMutI CAGTG 1 cut(s) 143
Cac8I GCNNGC 2 cut(s) 69, 247
CfoI GCGC 1 cut(s) 150
Cfr13I GGNCC 1 cut(s) 233
CviJI RGCY 7 cut(s) 16, 36, 61, 110, 133, 160, 165
CviKI_1 RGCY 7 cut(s) 16, 36, 61, 110, 133, 160, 165
DdeI CTNAG 1 cut(s) 267
Eam1104I CTCTTC 1 cut(s) 203
EarI CTCTTC 1 cut(s) 203
Eco47I GGWCC 1 cut(s) 233
Eco88I CYCGRG 2 cut(s) 166, 192
EcoO109I RGGNCCY 1 cut(s) 233
EcoRII CCWGG 1 cut(s) 160
EcoT22I ATGCAT 1 cut(s) 6
FaiI YATR 3 cut(s) 58, 180, 219
FspI TGCGCA 1 cut(s) 149
GlaI GCGC 1 cut(s) 149
GsaI CCCAGC 1 cut(s) 245
HaeIII GGCC 1 cut(s) 160
HhaI GCGC 1 cut(s) 150
Hin6I GCGC 1 cut(s) 148
HinP1I GCGC 1 cut(s) 148
HinfI GANTC 2 cut(s) 116, 214
Hpy188III TCNNGA 3 cut(s) 113, 168, 231
HpyCH4V TGCA 2 cut(s) 4, 143
HpyF10VI GCNNNNNNNGC 1 cut(s) 255
HpyF3I CTNAG 1 cut(s) 267
HspAI GCGC 1 cut(s) 148
LmnI GCTCC 1 cut(s) 66
LpnPI CCDG 8 cut(s) 77, 147, 153, 174, 187, 216, 231, 255
LweI GCATC 1 cut(s) 13
MboII GAAGA 3 cut(s) 38, 39, 220
MnlI CCTC 1 cut(s) 204
Mph1103I ATGCAT 1 cut(s) 6
MroXI GAANNNNTTC 1 cut(s) 120
MseI TTAA 2 cut(s) 18, 99
MspCI CTTAAG 1 cut(s) 17
MspR9I CCNGG 1 cut(s) 162
MvaI CCWGG 1 cut(s) 162
MwoI GCNNNNNNNGC 1 cut(s) 255
NlaIV GGNNCC 3 cut(s) 62, 172, 235
NsbI TGCGCA 1 cut(s) 149
NsiI ATGCAT 1 cut(s) 6
PdmI GAANNNNTTC 1 cut(s) 120
PfeI GAWTC 2 cut(s) 116, 214
PpuMI RGGWCCY 1 cut(s) 233
PshBI ATTAAT 1 cut(s) 99
Psp5II RGGWCCY 1 cut(s) 233
Psp6I CCWGG 1 cut(s) 160
PspFI CCCAGC 1 cut(s) 241
PspGI CCWGG 1 cut(s) 160
PspN4I GGNNCC 3 cut(s) 62, 172, 235
PspPI GGNCC 1 cut(s) 233
PspPPI RGGWCCY 1 cut(s) 233
SaqAI TTAA 2 cut(s) 18, 99
Sau96I GGNCC 1 cut(s) 233
ScrFI CCNGG 1 cut(s) 162
SetI ASST 4 cut(s) 18, 112, 135, 190
SfaNI GCATC 1 cut(s) 13
SinI GGWCC 1 cut(s) 233
SmlI CTYRAG 2 cut(s) 17, 105
SmoI CTYRAG 2 cut(s) 17, 105
StyD4I CCNGG 1 cut(s) 160
TfiI GAWTC 2 cut(s) 116, 214
Tru1I TTAA 2 cut(s) 18, 99
Tru9I TTAA 2 cut(s) 18, 99
TscAI CASTG 1 cut(s) 150
TspDTI ATGAA 2 cut(s) 32, 206
TspRI CASTG 1 cut(s) 150
Vha464I CTTAAG 1 cut(s) 17
VpaK11BI GGWCC 1 cut(s) 233
VspI ATTAAT 1 cut(s) 99
XmnI GAANNNNTTC 1 cut(s) 120
Zsp2I ATGCAT 1 cut(s) 6
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.