AT1G24405

No description available

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
1
Physical Location & Seq
Forward (+)
8654945 .. 8655662
718 bp
Loading structure...
UTR
Exon/CDS
Intron
AT1G24405.1

Sequence Viewer

Length: 186 bp
ATGGATTCTGGACTATCATGGGCTGATCAATGGGATTACAACTCTGATCCTCCTCCAAATTCAAGTAACGAAGACGATAAGAAGAAGAAGAAGAAGAAGAAGAAGGAAGATGGAAGCAAAAGCGGTATCGGGAAGGCCATACTTGGATTCAAATGGATGAAACTTGGCAAGAAATCTGATAAGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

61

Amino Acids

6.89

Weight (kDa)

9.62

Isoelectric Point (pI)

21.15

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0017914)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G24405 AT1G67670
fragaria_vesca FvH4_4g24600
prunus_persica Prupe.1G235000_v2.0.a1
rosa_chinensis RchiOBHm_Chr4g0431601
rosa_roxburghii Rroxscaffold_5G00373060
rosa_samantha Rh4AG307900 Rh4BG315500 Rh4CG331000 Rh4DG310400
rosa_wichuraiana Rw4G026690

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 123
AclWI GGATC 1 cut(s) 41
AcsI RAATTY 1 cut(s) 58
AgsI TTSAA 2 cut(s) 63, 151
AlwI GGATC 1 cut(s) 41
AoxI GGCC 1 cut(s) 135
ApoI RAATTY 1 cut(s) 58
BbsI GAAGAC 1 cut(s) 78
BccI CCATC 1 cut(s) 104
BclI TGATCA 1 cut(s) 25
BpiI GAAGAC 1 cut(s) 78
BseGI GGATG 1 cut(s) 162
BseRI GAGGAG 1 cut(s) 42
BshFI GGCC 1 cut(s) 137
BsnI GGCC 1 cut(s) 137
Bsp143I GATC 2 cut(s) 25, 46
BspACI CCGC 1 cut(s) 123
BspANI GGCC 1 cut(s) 137
BspPI GGATC 1 cut(s) 41
BssMI GATC 2 cut(s) 25, 46
BstF5I GGATG 1 cut(s) 162
BstKTI GATC 2 cut(s) 28, 49
BstMBI GATC 2 cut(s) 25, 46
BstV2I GAAGAC 1 cut(s) 78
BsuRI GGCC 1 cut(s) 137
BtsCI GGATG 1 cut(s) 162
CviAII CATG 1 cut(s) 18
CviJI RGCY 2 cut(s) 23, 137
CviKI_1 RGCY 2 cut(s) 23, 137
DpnI GATC 2 cut(s) 27, 48
DpnII GATC 2 cut(s) 25, 46
FaeI CATG 1 cut(s) 21
FaiI YATR 2 cut(s) 19, 140
FatI CATG 1 cut(s) 17
FbaI TGATCA 1 cut(s) 25
FokI GGATG 1 cut(s) 169
HaeIII GGCC 1 cut(s) 137
Hin1II CATG 1 cut(s) 21
HinfI GANTC 2 cut(s) 5, 147
Hpy188I TCNGA 2 cut(s) 46, 178
Hpy188III TCNNGA 2 cut(s) 9, 130
HpyAV CCTTC 2 cut(s) 97, 127
Hsp92II CATG 1 cut(s) 21
Ksp22I TGATCA 1 cut(s) 25
Kzo9I GATC 2 cut(s) 25, 46
MaeIII GTNAC 1 cut(s) 65
MalI GATC 2 cut(s) 27, 48
MboI GATC 2 cut(s) 25, 46
MboII GAAGA 9 cut(s) 83, 94, 97, 100, 103, 106, 109, 112, 119
MluCI AATT 1 cut(s) 58
MnlI CCTC 2 cut(s) 60, 63
NdeII GATC 2 cut(s) 25, 46
NlaIII CATG 1 cut(s) 21
PfeI GAWTC 2 cut(s) 5, 147
Sau3AI GATC 2 cut(s) 25, 46
SgeI CNNG 7 cut(s) 21, 30, 75, 142, 155, 176, 181
Sse9I AATT 1 cut(s) 58
SsiI CCGC 1 cut(s) 123
TasI AATT 1 cut(s) 58
TfiI GAWTC 2 cut(s) 5, 147
TspDTI ATGAA 1 cut(s) 173
XapI RAATTY 1 cut(s) 58
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.