AT1G67670

No description available

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
1
Physical Location & Seq
Forward (+)
25365370 .. 25365740
371 bp
Loading structure...
UTR
Exon/CDS
Intron
AT1G67670.1

Sequence Viewer

Length: 195 bp
ATGGATTCAGGGCCGTCGTGGGCTGATCAATGGGATTACAATAACCCTGACCCTCTACCGAGTTCGACGAAAGAGGATGAGAGCAAAAAGAAGAACAAGAAGAAGAAGGAAGAAGATGGAAGCAAAAGCAGTCTTGGGAAGACATTACTTGGGTTCAAATGGATGAAGGAGCTCCGCAAGAAATCTGAAAAGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

64

Amino Acids

7.4

Weight (kDa)

9.36

Isoelectric Point (pI)

46.46

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0017914)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G24405 AT1G67670
fragaria_vesca FvH4_4g24600
prunus_persica Prupe.1G235000_v2.0.a1
rosa_chinensis RchiOBHm_Chr4g0431601
rosa_roxburghii Rroxscaffold_5G00373060
rosa_samantha Rh4AG307900 Rh4BG315500 Rh4CG331000 Rh4DG310400
rosa_wichuraiana Rw4G026690

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 175
AgsI TTSAA 1 cut(s) 157
AluBI AGCT 1 cut(s) 172
AluI AGCT 1 cut(s) 172
Alw21I GWGCWC 1 cut(s) 174
AoxI GGCC 1 cut(s) 11
AspS9I GGNCC 1 cut(s) 11
BanII GRGCYC 1 cut(s) 174
BbsI GAAGAC 1 cut(s) 146
Bbv12I GWGCWC 1 cut(s) 174
BccI CCATC 1 cut(s) 110
BclI TGATCA 1 cut(s) 25
BmgT120I GGNCC 1 cut(s) 11
BpiI GAAGAC 1 cut(s) 146
BseGI GGATG 2 cut(s) 82, 168
BshFI GGCC 1 cut(s) 13
BsiHKAI GWGCWC 1 cut(s) 174
BsnI GGCC 1 cut(s) 13
Bsp1286I GDGCHC 1 cut(s) 174
Bsp143I GATC 1 cut(s) 25
BspACI CCGC 1 cut(s) 175
BspANI GGCC 1 cut(s) 13
BssMI GATC 1 cut(s) 25
BstF5I GGATG 2 cut(s) 82, 168
BstKTI GATC 1 cut(s) 28
BstMBI GATC 1 cut(s) 25
BstV2I GAAGAC 1 cut(s) 146
BsuRI GGCC 1 cut(s) 13
BtsCI GGATG 2 cut(s) 82, 168
Cfr13I GGNCC 1 cut(s) 11
CviJI RGCY 3 cut(s) 13, 23, 172
CviKI_1 RGCY 3 cut(s) 13, 23, 172
DpnI GATC 1 cut(s) 27
DpnII GATC 1 cut(s) 25
Ecl136II GAGCTC 1 cut(s) 172
Eco24I GRGCYC 1 cut(s) 174
Eco53kI GAGCTC 1 cut(s) 172
EcoICRI GAGCTC 1 cut(s) 172
EcoT38I GRGCYC 1 cut(s) 174
FbaI TGATCA 1 cut(s) 25
FokI GGATG 2 cut(s) 89, 175
FriOI GRGCYC 1 cut(s) 174
HaeIII GGCC 1 cut(s) 13
HinfI GANTC 1 cut(s) 5
Hpy188I TCNGA 1 cut(s) 187
Hpy99I CGWCG 2 cut(s) 19, 70
HpyAV CCTTC 2 cut(s) 100, 160
Ksp22I TGATCA 1 cut(s) 25
Kzo9I GATC 1 cut(s) 25
LmnI GCTCC 2 cut(s) 169, 177
LpnPI CCDG 1 cut(s) 60
MalI GATC 1 cut(s) 27
MboI GATC 1 cut(s) 25
MboII GAAGA 6 cut(s) 103, 112, 115, 122, 125, 151
MhlI GDGCHC 1 cut(s) 174
MnlI CCTC 2 cut(s) 63, 67
NdeII GATC 1 cut(s) 25
PfeI GAWTC 1 cut(s) 5
Psp124BI GAGCTC 1 cut(s) 174
PspPI GGNCC 1 cut(s) 11
SacI GAGCTC 1 cut(s) 174
Sau3AI GATC 1 cut(s) 25
Sau96I GGNCC 1 cut(s) 11
SduI GDGCHC 1 cut(s) 174
SetI ASST 1 cut(s) 174
SgeI CNNG 8 cut(s) 21, 30, 59, 72, 109, 146, 161, 190
SsiI CCGC 1 cut(s) 175
SstI GAGCTC 1 cut(s) 174
TaqI TCGA 1 cut(s) 65
TfiI GAWTC 1 cut(s) 5
TspDTI ATGAA 1 cut(s) 179
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.