Prupe.1G235000_v2.0.a1

No description available

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp01
Physical Location & Seq
Reverse (-)
24889703 .. 24890108
406 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.1G235000.1

Sequence Viewer

Length: 186 bp
ATGGATTCTGGTTTGTCCTGGGCTGATCAATGGGATAACAATCCCGACCCACCACCACCGGGATCATCAGAGAATGACAAGAAGAAGGGCAAGGATGGATCAAAGAGCAGTTTCGGGAAGGCAATTTTAAGCTTCAAGTGGGTGGAAAAGCTCCGGAAGAAATCTGCGAAAGAATCAGATTCATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

62

Amino Acids

6.73

Weight (kDa)

9.0

Isoelectric Point (pI)

28.19

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0017914)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G24405 AT1G67670
fragaria_vesca FvH4_4g24600
prunus_persica Prupe.1G235000_v2.0.a1
rosa_chinensis RchiOBHm_Chr4g0431601
rosa_roxburghii Rroxscaffold_5G00373060
rosa_samantha Rh4AG307900 Rh4BG315500 Rh4CG331000 Rh4DG310400
rosa_wichuraiana Rw4G026690

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccIII TCCGGA 1 cut(s) 153
AclWI GGATC 2 cut(s) 70, 106
AfiI CCNNNNNNNGG 1 cut(s) 59
AgsI TTSAA 1 cut(s) 136
AjnI CCWGG 1 cut(s) 17
AluBI AGCT 2 cut(s) 132, 151
AluI AGCT 2 cut(s) 132, 151
AlwI GGATC 2 cut(s) 70, 106
Aor13HI TCCGGA 1 cut(s) 153
AsuC2I CCSGG 1 cut(s) 60
BccI CCATC 1 cut(s) 89
BciT130I CCWGG 1 cut(s) 19
BclI TGATCA 1 cut(s) 25
BcnI CCSGG 1 cut(s) 60
Bme1390I CCNGG 2 cut(s) 19, 60
BmrFI CCNGG 2 cut(s) 19, 60
BpuMI CCSGG 1 cut(s) 60
BsaBI GATNNNNATC 1 cut(s) 39
BsaJI CCNNGG 1 cut(s) 18
BsaWI WCCGGW 1 cut(s) 153
Bsc4I CCNNNNNNNGG 1 cut(s) 59
Bse8I GATNNNNATC 1 cut(s) 39
BseAI TCCGGA 1 cut(s) 153
BseBI CCWGG 1 cut(s) 19
BseDI CCNNGG 1 cut(s) 18
BseGI GGATG 1 cut(s) 100
BseJI GATNNNNATC 1 cut(s) 39
BseLI CCNNNNNNNGG 1 cut(s) 59
BsiSI CCGG 2 cut(s) 59, 154
BslI CCNNNNNNNGG 1 cut(s) 59
Bsp13I TCCGGA 1 cut(s) 153
Bsp143I GATC 3 cut(s) 25, 62, 98
BspEI TCCGGA 1 cut(s) 153
BspPI GGATC 2 cut(s) 70, 106
BssECI CCNNGG 1 cut(s) 18
BssMI GATC 3 cut(s) 25, 62, 98
Bst2UI CCWGG 1 cut(s) 19
BstF5I GGATG 1 cut(s) 100
BstKTI GATC 3 cut(s) 28, 65, 101
BstMBI GATC 3 cut(s) 25, 62, 98
BstNI CCWGG 1 cut(s) 19
BstSCI CCNGG 2 cut(s) 17, 58
BtsCI GGATG 1 cut(s) 100
CviJI RGCY 3 cut(s) 23, 132, 151
CviKI_1 RGCY 3 cut(s) 23, 132, 151
DpnI GATC 3 cut(s) 27, 64, 100
DpnII GATC 3 cut(s) 25, 62, 98
EcoRII CCWGG 1 cut(s) 17
FaiI YATR 1 cut(s) 184
FbaI TGATCA 1 cut(s) 25
FokI GGATG 1 cut(s) 107
HapII CCGG 2 cut(s) 59, 154
HindIII AAGCTT 1 cut(s) 130
HinfI GANTC 3 cut(s) 5, 173, 179
HpaII CCGG 2 cut(s) 59, 154
Hpy188I TCNGA 2 cut(s) 70, 178
Hpy188III TCNNGA 3 cut(s) 44, 115, 154
HpyAV CCTTC 2 cut(s) 79, 112
Kpn2I TCCGGA 1 cut(s) 153
Ksp22I TGATCA 1 cut(s) 25
Kzo9I GATC 3 cut(s) 25, 62, 98
LmnI GCTCC 1 cut(s) 156
LpnPI CCDG 4 cut(s) 4, 31, 72, 167
MalI GATC 3 cut(s) 27, 64, 100
MboI GATC 3 cut(s) 25, 62, 98
MboII GAAGA 2 cut(s) 94, 169
MluCI AATT 1 cut(s) 123
MroI TCCGGA 1 cut(s) 153
MseI TTAA 1 cut(s) 128
MspI CCGG 2 cut(s) 59, 154
MspR9I CCNGG 2 cut(s) 19, 60
MvaI CCWGG 1 cut(s) 19
NciI CCSGG 1 cut(s) 60
NdeII GATC 3 cut(s) 25, 62, 98
PfeI GAWTC 3 cut(s) 5, 173, 179
Psp6I CCWGG 1 cut(s) 17
PspGI CCWGG 1 cut(s) 17
SaqAI TTAA 1 cut(s) 128
Sau3AI GATC 3 cut(s) 25, 62, 98
ScrFI CCNGG 2 cut(s) 19, 60
SetI ASST 2 cut(s) 134, 153
Sse9I AATT 1 cut(s) 123
StyD4I CCNGG 2 cut(s) 17, 58
TasI AATT 1 cut(s) 123
TfiI GAWTC 3 cut(s) 5, 173, 179
Tru1I TTAA 1 cut(s) 128
Tru9I TTAA 1 cut(s) 128
TspDTI ATGAA 1 cut(s) 171
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.