AT1G28250

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
1
OG0012963
Physical Location & Seq
Forward (+)
9874247 .. 9875579
1333 bp
Loading structure...
UTR
Exon/CDS
Intron
AT1G28250.1

Sequence Viewer

Length: 309 bp
ATGGAGAAGAAATCTCAGATTTCGTCAACGGAAGCTGTTTTCCTTGGAGCTCTAGCTCCAGGCGTTAATGGTCCAACATGGAACACATTGAGATTCGCGTTTCTGCTACTGGGTCTATGTCTAGCTTTCATGCTCTCTGTAGCTTTCACCAGTGGCCAATCAATGTTGCTTGTTCATGTTGGCTTTCTCATTGTTATCGCATCTACTCTCTTTATCCTCCTCAATTGGTTTCTTGCTCAGACAGGCTTAGTACAAGTGGAAACACAAATGCAGGAGCTGAATTTGTTACCGAATGATAAAACCAAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

102

Amino Acids

11.16

Weight (kDa)

6.53

Isoelectric Point (pI)

21.24

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0012963)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G28250
fragaria_vesca FvH4_3g08990 FvH4_3g08990
malus_domestica MD00G1116000.v1.1 MD10G1292600.v1.1
prunus_persica Prupe.4G049200_v2.0.a1
pyrus_communis pycom10g24470
rosa_chinensis RchiOBHm_Chr5g0008721
rosa_laevigata RLG00000031595
rosa_multiflora Rmu_sc0001665.1_g000042 Rmu_sc0042141.1_g000001
rosa_roxburghii Rroxscaffold_1G00067870
rosa_rugosa Rorug04G0438000
rosa_samantha Rh5AG066800 Rh5BG063900 Rh5CG074300 Rh5DG062300
rosa_wichuraiana Rw5G006210

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 98
AcoI YGGCCR 1 cut(s) 154
AcsI RAATTY 1 cut(s) 280
AfaI GTAC 1 cut(s) 252
AjnI CCWGG 1 cut(s) 58
AluBI AGCT 6 cut(s) 35, 50, 56, 125, 143, 277
AluI AGCT 6 cut(s) 35, 50, 56, 125, 143, 277
Alw21I GWGCWC 1 cut(s) 52
AlwNI CAGNNNCTG 1 cut(s) 277
AoxI GGCC 1 cut(s) 154
ApoI RAATTY 1 cut(s) 280
AspS9I GGNCC 1 cut(s) 71
AsuHPI GGTGA 1 cut(s) 139
AvaII GGWCC 1 cut(s) 71
BalI TGGCCA 1 cut(s) 156
BanII GRGCYC 1 cut(s) 52
Bbv12I GWGCWC 1 cut(s) 52
BciT130I CCWGG 1 cut(s) 60
BfaI CTAG 2 cut(s) 53, 122
BfmI CTRYAG 1 cut(s) 138
Bme1390I CCNGG 1 cut(s) 60
Bme18I GGWCC 1 cut(s) 71
BmgT120I GGNCC 1 cut(s) 71
BmrFI CCNGG 1 cut(s) 60
BmrI ACTGGG 1 cut(s) 119
BmsI GCATC 1 cut(s) 209
BmuI ACTGGG 1 cut(s) 119
BpmI CTGGAG 1 cut(s) 42
BsaJI CCNNGG 1 cut(s) 43
Bse1I ACTGG 2 cut(s) 114, 150
BseBI CCWGG 1 cut(s) 60
BseDI CCNNGG 1 cut(s) 43
BseMII CTCAG 2 cut(s) 29, 251
BseNI ACTGG 2 cut(s) 114, 150
BseRI GAGGAG 1 cut(s) 209
Bsh1236I CGCG 1 cut(s) 98
BshFI GGCC 1 cut(s) 156
BsiHKAI GWGCWC 1 cut(s) 52
BsnI GGCC 1 cut(s) 156
Bsp1286I GDGCHC 1 cut(s) 52
BspANI GGCC 1 cut(s) 156
BspCNI CTCAG 2 cut(s) 28, 250
BspFNI CGCG 1 cut(s) 98
BsrI ACTGG 2 cut(s) 114, 150
BssECI CCNNGG 1 cut(s) 43
BssT1I CCWWGG 1 cut(s) 43
Bst2UI CCWGG 1 cut(s) 60
BstDEI CTNAG 3 cut(s) 15, 237, 247
BstFNI CGCG 1 cut(s) 98
BstNI CCWGG 1 cut(s) 60
BstSCI CCNGG 1 cut(s) 58
BstSFI CTRYAG 1 cut(s) 138
BstUI CGCG 1 cut(s) 98
BsuRI GGCC 1 cut(s) 156
BtsIMutI CAGTG 1 cut(s) 157
CaiI CAGNNNCTG 1 cut(s) 277
Cfr13I GGNCC 1 cut(s) 71
Csp6I GTAC 1 cut(s) 251
CviAII CATG 3 cut(s) 78, 130, 176
CviJI RGCY 9 cut(s) 35, 50, 56, 125, 143, 156, 183, 246, 277
CviKI_1 RGCY 9 cut(s) 35, 50, 56, 125, 143, 156, 183, 246, 277
CviQI GTAC 1 cut(s) 251
DdeI CTNAG 3 cut(s) 15, 237, 247
EaeI YGGCCR 1 cut(s) 154
Ecl136II GAGCTC 1 cut(s) 50
Eco130I CCWWGG 1 cut(s) 43
Eco24I GRGCYC 1 cut(s) 52
Eco47I GGWCC 1 cut(s) 71
Eco53kI GAGCTC 1 cut(s) 50
EcoICRI GAGCTC 1 cut(s) 50
EcoRII CCWGG 1 cut(s) 58
EcoT14I CCWWGG 1 cut(s) 43
EcoT38I GRGCYC 1 cut(s) 52
ErhI CCWWGG 1 cut(s) 43
FaeI CATG 3 cut(s) 81, 133, 179
FaiI YATR 4 cut(s) 79, 118, 131, 177
FatI CATG 3 cut(s) 77, 129, 175
FriOI GRGCYC 1 cut(s) 52
FspBI CTAG 2 cut(s) 53, 122
GsuI CTGGAG 1 cut(s) 42
HaeIII GGCC 1 cut(s) 156
Hin1II CATG 3 cut(s) 81, 133, 179
HincII GTYRAC 1 cut(s) 27
HindII GTYRAC 1 cut(s) 27
HinfI GANTC 1 cut(s) 93
HphI GGTGA 1 cut(s) 139
Hpy166II GTNNAC 1 cut(s) 27
Hpy188I TCNGA 2 cut(s) 18, 240
Hpy8I GTNNAC 1 cut(s) 27
HpyCH4V TGCA 1 cut(s) 271
HpyF3I CTNAG 3 cut(s) 15, 237, 247
Hsp92II CATG 3 cut(s) 81, 133, 179
LmnI GCTCC 3 cut(s) 47, 61, 274
LpnPI CCDG 6 cut(s) 45, 72, 95, 163, 228, 257
LweI GCATC 1 cut(s) 209
MaeI CTAG 2 cut(s) 53, 122
MaeIII GTNAC 1 cut(s) 285
MboII GAAGA 1 cut(s) 19
MfeI CAATTG 1 cut(s) 223
MhlI GDGCHC 1 cut(s) 52
MlsI TGGCCA 1 cut(s) 156
MluCI AATT 2 cut(s) 223, 280
MluNI TGGCCA 1 cut(s) 156
MmeI TCCRAC 1 cut(s) 98
MnlI CCTC 2 cut(s) 227, 230
Mox20I TGGCCA 1 cut(s) 156
MscI TGGCCA 1 cut(s) 156
MseI TTAA 1 cut(s) 66
Msp20I TGGCCA 1 cut(s) 156
MspR9I CCNGG 1 cut(s) 60
MunI CAATTG 1 cut(s) 223
MvaI CCWGG 1 cut(s) 60
MvnI CGCG 1 cut(s) 98
NlaIII CATG 3 cut(s) 81, 133, 179
PfeI GAWTC 1 cut(s) 93
Psp124BI GAGCTC 1 cut(s) 52
Psp6I CCWGG 1 cut(s) 58
PspGI CCWGG 1 cut(s) 58
PspPI GGNCC 1 cut(s) 71
PstNI CAGNNNCTG 1 cut(s) 277
RsaI GTAC 1 cut(s) 252
RsaNI GTAC 1 cut(s) 251
SacI GAGCTC 1 cut(s) 52
SaqAI TTAA 1 cut(s) 66
Sau96I GGNCC 1 cut(s) 71
ScrFI CCNGG 1 cut(s) 60
SduI GDGCHC 1 cut(s) 52
SetI ASST 6 cut(s) 37, 52, 58, 127, 145, 279
SfaNI GCATC 1 cut(s) 209
SfcI CTRYAG 1 cut(s) 138
SinI GGWCC 1 cut(s) 71
Sse9I AATT 2 cut(s) 223, 280
SspMI CTAG 2 cut(s) 53, 122
SstI GAGCTC 1 cut(s) 52
StyD4I CCNGG 1 cut(s) 58
StyI CCWWGG 1 cut(s) 43
TasI AATT 2 cut(s) 223, 280
TatI WGTACW 1 cut(s) 250
TfiI GAWTC 1 cut(s) 93
Tru1I TTAA 1 cut(s) 66
Tru9I TTAA 1 cut(s) 66
TscAI CASTG 1 cut(s) 157
TspDTI ATGAA 2 cut(s) 118, 164
TspGWI ACGGA 1 cut(s) 44
TspRI CASTG 1 cut(s) 157
VpaK11BI GGWCC 1 cut(s) 71
XapI RAATTY 1 cut(s) 280
XspI CTAG 2 cut(s) 53, 122
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.