AT1G60870

No description available

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
1
Physical Location & Seq
Forward (+)
22409298 .. 22410854
1557 bp
Loading structure...
UTR
Exon/CDS
Intron
AT1G60870.1

Sequence Viewer

Length: 444 bp
ATGGAAGCTCTAATTCACCACTTCACTCTCCTCTCCGATCAAGCTCTTGTCGACAAAACATTCGACCCTTCAAGAATCGAGGACCTCATGCGTCTCTTTGAAGTCGATTCATACAAAGCTTGGGCAGCTCTCGAATCCGAACAGCAACAAGAACTCGAAGAAGCTGAAGAATCTCTCCGTGAAGCTGAACTTGAACTTGATCGGGATATGGAGTGGGGGATGGAGGAGTATAGGCGGACGTTGGAGGAGATGGAGAGGATGGAGGCGGCGGAGCTGAAAGAGCTTGAGGAGAAAGCGGAGACTGCTCGGAGAACGGGGAATTTAATGGAGAAAGCGGCGACAGTTGCCGCGAAACGACATATTGCGGCGGCGATGGGATCAGCCGCCGCGTCTATGAGATCAGCTTGGAAGACTGCAGCTGGAAATAAGGTTCATCCATCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

147

Amino Acids

16.77

Weight (kDa)

4.73

Isoelectric Point (pI)

50.62

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0010890)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 51
AccII CGCG 2 cut(s) 350, 389
AclWI GGATC 1 cut(s) 385
AcsI RAATTY 1 cut(s) 319
AcuI CTGAAG 1 cut(s) 186
AgsI TTSAA 3 cut(s) 72, 101, 194
AloI GAACNNNNNNTCC 1 cut(s) 414
Alw26I GTCTC 2 cut(s) 98, 293
AlwI GGATC 1 cut(s) 385
ApeKI GCWGC 2 cut(s) 125, 416
ApoI RAATTY 1 cut(s) 319
ArsI GACNNNNNNTTYG 2 cut(s) 44, 76
AspS9I GGNCC 1 cut(s) 82
AsuHPI GGTGA 1 cut(s) 8
AvaII GGWCC 1 cut(s) 82
BbsI GAAGAC 1 cut(s) 416
BbvI GCAGC 2 cut(s) 137, 428
BccI CCATC 4 cut(s) 214, 244, 253, 367
BcoDI GTCTC 2 cut(s) 98, 293
BfmI CTRYAG 1 cut(s) 414
BisI GCNGC 9 cut(s) 126, 267, 336, 348, 366, 369, 384, 387, 417
BlsI GCNGC 9 cut(s) 127, 268, 337, 349, 367, 370, 385, 388, 418
Bme18I GGWCC 1 cut(s) 82
BmgT120I GGNCC 1 cut(s) 82
BpiI GAAGAC 1 cut(s) 416
BpuEI CTTGAG 1 cut(s) 305
BseGI GGATG 3 cut(s) 225, 264, 433
BseRI GAGGAG 4 cut(s) 20, 239, 260, 302
BseXI GCAGC 2 cut(s) 137, 428
Bsh1236I CGCG 2 cut(s) 350, 389
BsmAI GTCTC 2 cut(s) 98, 293
BsmBI CGTCTC 1 cut(s) 98
Bsp143I GATC 4 cut(s) 37, 199, 377, 398
BspFNI CGCG 2 cut(s) 350, 389
BspMAI CTGCAG 1 cut(s) 418
BspPI GGATC 1 cut(s) 385
BssMI GATC 4 cut(s) 37, 199, 377, 398
Bst4CI ACNGT 1 cut(s) 343
BstF5I GGATG 3 cut(s) 225, 264, 433
BstFNI CGCG 2 cut(s) 350, 389
BstKTI GATC 4 cut(s) 40, 202, 380, 401
BstMAI GTCTC 2 cut(s) 98, 293
BstMBI GATC 4 cut(s) 37, 199, 377, 398
BstMWI GCNNNNNNNGC 4 cut(s) 125, 280, 302, 344
BstSFI CTRYAG 1 cut(s) 414
BstUI CGCG 2 cut(s) 350, 389
BstV1I GCAGC 2 cut(s) 137, 428
BstV2I GAAGAC 1 cut(s) 416
BtgZI GCGATG 1 cut(s) 386
BtsCI GGATG 3 cut(s) 225, 264, 433
Cfr13I GGNCC 1 cut(s) 82
CseI GACGC 2 cut(s) 80, 378
CviAII CATG 1 cut(s) 88
DpnI GATC 4 cut(s) 39, 201, 379, 400
DpnII GATC 4 cut(s) 37, 199, 377, 398
EciI GGCGGA 2 cut(s) 250, 284
Eco47I GGWCC 1 cut(s) 82
Eco57I CTGAAG 1 cut(s) 186
EcoO109I RGGNCCY 1 cut(s) 82
Esp3I CGTCTC 1 cut(s) 98
FaeI CATG 1 cut(s) 91
FaiI YATR 6 cut(s) 89, 112, 209, 231, 360, 395
FalI AAGNNNNNCTT 2 cut(s) 174, 206
FatI CATG 1 cut(s) 87
FblI GTMKAC 1 cut(s) 51
Fnu4HI GCNGC 9 cut(s) 126, 267, 336, 348, 366, 369, 384, 387, 417
FokI GGATG 3 cut(s) 232, 271, 420
Fsp4HI GCNGC 9 cut(s) 126, 267, 336, 348, 366, 369, 384, 387, 417
GluI GCNGC 9 cut(s) 126, 267, 336, 348, 366, 369, 384, 387, 417
HgaI GACGC 2 cut(s) 80, 378
Hin1II CATG 1 cut(s) 91
HincII GTYRAC 1 cut(s) 52
HindII GTYRAC 1 cut(s) 52
HindIII AAGCTT 1 cut(s) 117
HinfI GANTC 4 cut(s) 75, 107, 134, 170
HphI GGTGA 1 cut(s) 8
Hpy166II GTNNAC 1 cut(s) 52
Hpy188I TCNGA 3 cut(s) 37, 139, 309
Hpy188III TCNNGA 4 cut(s) 72, 131, 203, 441
Hpy8I GTNNAC 1 cut(s) 52
HpyAV CCTTC 1 cut(s) 78
HpyCH4III ACNGT 1 cut(s) 343
HpyCH4IV ACGT 1 cut(s) 239
HpyCH4V TGCA 1 cut(s) 416
HpyF10VI GCNNNNNNNGC 4 cut(s) 125, 280, 302, 344
HpySE526I ACGT 1 cut(s) 239
Hsp92II CATG 1 cut(s) 91
Kzo9I GATC 4 cut(s) 37, 199, 377, 398
LmnI GCTCC 1 cut(s) 271
LpnPI CCDG 1 cut(s) 405
Lsp1109I GCAGC 2 cut(s) 137, 428
MaeII ACGT 1 cut(s) 239
MalI GATC 4 cut(s) 39, 201, 379, 400
MboI GATC 4 cut(s) 37, 199, 377, 398
MboII GAAGA 3 cut(s) 170, 179, 421
MluCI AATT 2 cut(s) 12, 319
MmeI TCCRAC 1 cut(s) 222
MnlI CCTC 8 cut(s) 41, 73, 95, 217, 238, 249, 256, 280
MseI TTAA 1 cut(s) 323
MspA1I CMGCKG 1 cut(s) 419
MvnI CGCG 2 cut(s) 350, 389
MwoI GCNNNNNNNGC 4 cut(s) 125, 280, 302, 344
NdeII GATC 4 cut(s) 37, 199, 377, 398
NlaIII CATG 1 cut(s) 91
PfeI GAWTC 4 cut(s) 75, 107, 134, 170
PkrI GCNGC 9 cut(s) 127, 268, 337, 349, 367, 370, 385, 388, 418
PpuMI RGGWCCY 1 cut(s) 82
Psp5II RGGWCCY 1 cut(s) 82
PspPI GGNCC 1 cut(s) 82
PspPPI RGGWCCY 1 cut(s) 82
PstI CTGCAG 1 cut(s) 418
PvuII CAGCTG 1 cut(s) 419
SalI GTCGAC 1 cut(s) 50
SaqAI TTAA 1 cut(s) 323
SatI GCNGC 9 cut(s) 126, 267, 336, 348, 366, 369, 384, 387, 417
Sau3AI GATC 4 cut(s) 37, 199, 377, 398
Sau96I GGNCC 1 cut(s) 82
SfcI CTRYAG 1 cut(s) 414
SinI GGWCC 1 cut(s) 82
SmlI CTYRAG 1 cut(s) 284
SmoI CTYRAG 1 cut(s) 284
Sse9I AATT 2 cut(s) 12, 319
TaaI ACNGT 1 cut(s) 343
TaiI ACGT 1 cut(s) 242
TaqI TCGA 6 cut(s) 51, 63, 78, 105, 132, 156
TasI AATT 2 cut(s) 12, 319
TauI GCSGC 7 cut(s) 269, 338, 350, 368, 371, 386, 389
TfiI GAWTC 4 cut(s) 75, 107, 134, 170
Tru1I TTAA 1 cut(s) 323
Tru9I TTAA 1 cut(s) 323
TseI GCWGC 2 cut(s) 125, 416
TspDTI ATGAA 2 cut(s) 99, 422
TspGWI ACGGA 1 cut(s) 167
VpaK11BI GGWCC 1 cut(s) 82
XapI RAATTY 1 cut(s) 319
XmiI GTMKAC 1 cut(s) 51
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.