AT2G04630

DNA-dependent RNA polymerase catalyzes the transcription of DNA into RNA using the four ribonucleoside triphosphates as substrates. Component of RNA polymerase II which synthesizes mRNA precursors and many functional non-coding RNAs. Pol II is the central component of the basal RNA polymerase II transcription machinery. It is composed of mobile elements that move relative to each other. Component of RNA

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
2
Physical Location & Seq
Reverse (-)
1618791 .. 1620379
1589 bp
Loading structure...
UTR
Exon/CDS
Intron
AT2G04630.1

Sequence Viewer

Length: 435 bp
ATGGCTGACGACGATTACAATGAAGTCGATGACTTGGGATATGAAGATGAGCCAGCAGAGCCTGAGATCGAAGAAGGAGTAGAGGAAGATGCTGATATCAAGGAGAACGATGATGTTAATGTTGACCCTTTGGAAACAGAAGATAAGGTTGAAACAGAACCTGTGCAACGCCCACGTAAAACCTCTAAGTTTATGACTAAGTATGAACGTGCACGTATCCTCGGCACTCGTGCTTTGCAGATTAGCATGAATGCTCCTGTTATGGTTGAGTTGGAGGGTGAGACTGATCCACTTGAGATTGCGATGAAAGAGCTTAGGCAAAGGAAGATTCCATTTACCATTAGACGTTATCTACCTGATATGAGTTACGAGGAATGGGGAGTTGATGAACTGATCGTCGAAGACTCGTGGAAACGTCAAGTCGGTGGTGATTGA

Protein Analysis

144

Amino Acids

16.74

Weight (kDa)

4.2

Isoelectric Point (pI)

49.63

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
RNA_pol_Rpb6 PF01192 61 - 112 4.2e-12 RNA polymerase Rpb6
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0012428)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 281
AgsI TTSAA 1 cut(s) 152
AluBI AGCT 1 cut(s) 313
AluI AGCT 1 cut(s) 313
Alw21I GWGCWC 1 cut(s) 214
Alw26I GTCTC 1 cut(s) 275
Alw44I GTGCAC 1 cut(s) 210
AlwI GGATC 1 cut(s) 281
AlwNI CAGNNNCTG 2 cut(s) 62, 161
ApaLI GTGCAC 1 cut(s) 210
AsuHPI GGTGA 1 cut(s) 290
BaeGI GKGCMC 1 cut(s) 214
BauI CACGAG 2 cut(s) 228, 406
BbsI GAAGAC 1 cut(s) 408
Bbv12I GWGCWC 1 cut(s) 214
BciVI GTATCC 1 cut(s) 227
BcoDI GTCTC 1 cut(s) 275
BfuI GTATCC 1 cut(s) 227
BmsI GCATC 1 cut(s) 79
BpiI GAAGAC 1 cut(s) 408
Bpu10I CCTNAGC 1 cut(s) 314
BpuEI CTTGAG 1 cut(s) 314
BsaAI YACGTR 2 cut(s) 176, 215
BsaJI CCNNGG 1 cut(s) 220
BseDI CCNNGG 1 cut(s) 220
BseMII CTCAG 1 cut(s) 54
BseSI GKGCMC 1 cut(s) 214
BsiHKAI GWGCWC 1 cut(s) 214
BsmAI GTCTC 1 cut(s) 275
BsmI GAATGC 1 cut(s) 256
Bsp1286I GDGCHC 1 cut(s) 214
Bsp143I GATC 3 cut(s) 66, 286, 393
BspCNI CTCAG 1 cut(s) 55
BspPI GGATC 1 cut(s) 281
BssECI CCNNGG 1 cut(s) 220
BssMI GATC 3 cut(s) 66, 286, 393
BssSI CACGAG 2 cut(s) 228, 406
Bst2BI CACGAG 2 cut(s) 228, 406
BstBAI YACGTR 2 cut(s) 176, 215
BstC8I GCNNGC 1 cut(s) 54
BstDEI CTNAG 4 cut(s) 63, 186, 198, 314
BstKTI GATC 3 cut(s) 69, 289, 396
BstMAI GTCTC 1 cut(s) 275
BstMBI GATC 3 cut(s) 66, 286, 393
BstMWI GCNNNNNNNGC 1 cut(s) 58
BstSLI GKGCMC 1 cut(s) 214
BstV2I GAAGAC 1 cut(s) 408
BsuI GTATCC 1 cut(s) 227
BtgZI GCGATG 1 cut(s) 317
Cac8I GCNNGC 1 cut(s) 54
CaiI CAGNNNCTG 2 cut(s) 62, 161
CviAII CATG 1 cut(s) 247
CviJI RGCY 4 cut(s) 5, 52, 61, 313
CviKI_1 RGCY 4 cut(s) 5, 52, 61, 313
DdeI CTNAG 4 cut(s) 63, 186, 198, 314
DpnI GATC 3 cut(s) 68, 288, 395
DpnII GATC 3 cut(s) 66, 286, 393
Eco32I GATATC 1 cut(s) 97
EcoRV GATATC 1 cut(s) 97
FaeI CATG 1 cut(s) 250
FaiI YATR 6 cut(s) 42, 194, 204, 248, 263, 362
FatI CATG 1 cut(s) 246
Hin1II CATG 1 cut(s) 250
HincII GTYRAC 1 cut(s) 124
HindII GTYRAC 1 cut(s) 124
HinfI GANTC 2 cut(s) 328, 404
HphI GGTGA 1 cut(s) 290
Hpy166II GTNNAC 2 cut(s) 124, 212
Hpy8I GTNNAC 2 cut(s) 124, 212
Hpy99I CGWCG 2 cut(s) 14, 401
HpyAV CCTTC 1 cut(s) 68
HpyCH4IV ACGT 5 cut(s) 175, 208, 214, 346, 415
HpyCH4V TGCA 3 cut(s) 166, 212, 238
HpyF10VI GCNNNNNNNGC 1 cut(s) 58
HpyF3I CTNAG 4 cut(s) 63, 186, 198, 314
HpySE526I ACGT 5 cut(s) 175, 208, 214, 346, 415
Hsp92II CATG 1 cut(s) 250
Kzo9I GATC 3 cut(s) 66, 286, 393
LmnI GCTCC 1 cut(s) 259
LpnPI CCDG 5 cut(s) 66, 75, 174, 270, 369
LweI GCATC 1 cut(s) 79
MaeII ACGT 5 cut(s) 175, 208, 214, 346, 415
MaeIII GTNAC 1 cut(s) 365
MalI GATC 3 cut(s) 68, 288, 395
MboI GATC 3 cut(s) 66, 286, 393
MboII GAAGA 6 cut(s) 56, 83, 98, 152, 337, 413
MhlI GDGCHC 1 cut(s) 214
MlyI GAGTC 1 cut(s) 398
MmeI TCCRAC 1 cut(s) 252
MnlI CCTC 5 cut(s) 76, 193, 230, 268, 364
MseI TTAA 1 cut(s) 117
Mva1269I GAATGC 1 cut(s) 256
MwoI GCNNNNNNNGC 1 cut(s) 58
NdeII GATC 3 cut(s) 66, 286, 393
NlaIII CATG 1 cut(s) 250
NmeAIII GCCGAG 1 cut(s) 201
PctI GAATGC 1 cut(s) 256
PfeI GAWTC 1 cut(s) 328
PleI GAGTC 1 cut(s) 398
PpsI GAGTC 1 cut(s) 398
Ppu21I YACGTR 2 cut(s) 176, 215
PstNI CAGNNNCTG 2 cut(s) 62, 161
SaqAI TTAA 1 cut(s) 117
Sau3AI GATC 3 cut(s) 66, 286, 393
SchI GAGTC 1 cut(s) 398
SduI GDGCHC 1 cut(s) 214
SfaNI GCATC 1 cut(s) 79
SmlI CTYRAG 1 cut(s) 293
SmoI CTYRAG 1 cut(s) 293
TaiI ACGT 5 cut(s) 178, 211, 217, 349, 418
TaqI TCGA 3 cut(s) 27, 69, 399
TfiI GAWTC 1 cut(s) 328
Tru1I TTAA 1 cut(s) 117
Tru9I TTAA 1 cut(s) 117
TspDTI ATGAA 6 cut(s) 36, 57, 219, 263, 320, 402
VneI GTGCAC 1 cut(s) 210
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.